Incidental Mutation 'R7233:Gfra4'
ID562605
Institutional Source Beutler Lab
Gene Symbol Gfra4
Ensembl Gene ENSMUSG00000027316
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 4
SynonymsGFR alpha-4, G630015H18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131039632-131043088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131041117 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 194 (V194E)
Ref Sequence ENSEMBL: ENSMUSP00000028787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028787] [ENSMUST00000066958] [ENSMUST00000110234] [ENSMUST00000110235] [ENSMUST00000110239] [ENSMUST00000110240]
Predicted Effect probably damaging
Transcript: ENSMUST00000028787
AA Change: V194E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028787
Gene: ENSMUSG00000027316
AA Change: V194E

DomainStartEndE-ValueType
GDNF 35 120 6.76e-17 SMART
GDNF 132 226 1.2e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000066958
AA Change: V185E

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068357
Gene: ENSMUSG00000027316
AA Change: V185E

DomainStartEndE-ValueType
GDNF 26 111 6.76e-17 SMART
GDNF 123 217 1.2e-31 SMART
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110234
SMART Domains Protein: ENSMUSP00000105863
Gene: ENSMUSG00000027316

DomainStartEndE-ValueType
GDNF 35 120 6.76e-17 SMART
low complexity region 132 147 N/A INTRINSIC
low complexity region 169 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110235
SMART Domains Protein: ENSMUSP00000105864
Gene: ENSMUSG00000027316

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GDNF 26 111 6.76e-17 SMART
low complexity region 123 138 N/A INTRINSIC
low complexity region 160 181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110239
AA Change: V194E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105868
Gene: ENSMUSG00000027316
AA Change: V194E

DomainStartEndE-ValueType
GDNF 35 120 6.76e-17 SMART
GDNF 132 226 1.2e-31 SMART
low complexity region 257 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110240
AA Change: V185E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105869
Gene: ENSMUSG00000027316
AA Change: V185E

DomainStartEndE-ValueType
GDNF 26 111 6.76e-17 SMART
GDNF 123 217 1.2e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that functions as the receptor for persephin, a member of the glial cell line derived neurotrophic factors. The encoded protein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-anchored cell surface coreceptor that forms a complex with the receptor tyrosine kinase Ret. A complete lack of the encoded protein impairs production of thyroid calcitonin and increases the rate of bone formation in young mice. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations are mice were viable, fertile, showed no overt anatomical defects. Thyroid tissue calcitonin content was reduced in null homozygotes and rate of bone formation was enhanced when in 129/B6 hybrid background strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Cfap44 T A 16: 44,422,408 L725Q probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Dopey1 G A 9: 86,521,696 A186T probably benign Het
Engase T A 11: 118,483,001 V323E probably damaging Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Fscn1 C T 5: 142,970,274 S366L possibly damaging Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pkdrej A G 15: 85,821,148 S196P probably damaging Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prmt7 A G 8: 106,220,010 T75A probably damaging Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Slc44a2 G T 9: 21,348,149 probably null Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Gfra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Gfra4 APN 2 131040283 missense possibly damaging 0.82
IGL02966:Gfra4 APN 2 131042640 missense possibly damaging 0.73
R0625:Gfra4 UTSW 2 131040256 missense probably null 0.05
R2285:Gfra4 UTSW 2 131041731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAATAAGACCCACGGGCC -3'
(R):5'- TCTGAGTACGTGGCACGATG -3'

Sequencing Primer
(F):5'- GCCAGGCAGCTTGGATTG -3'
(R):5'- TTCCAGGCCTCATGCGC -3'
Posted On2019-06-26