Incidental Mutation 'R0577:Zfp141'
ID56261
Institutional Source Beutler Lab
Gene Symbol Zfp141
Ensembl Gene ENSMUSG00000092416
Gene Namezinc finger protein 141
Synonyms
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0577 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42473386-42505740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42476514 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 178 (N178S)
Ref Sequence ENSEMBL: ENSMUSP00000133899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173489] [ENSMUST00000174407]
Predicted Effect probably benign
Transcript: ENSMUST00000173489
Predicted Effect probably benign
Transcript: ENSMUST00000174407
AA Change: N178S

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133899
Gene: ENSMUSG00000092416
AA Change: N178S

DomainStartEndE-ValueType
KRAB 18 78 4.41e-34 SMART
internal_repeat_1 146 405 8.73e-7 PROSPERO
ZnF_C2H2 410 432 4.54e-4 SMART
ZnF_C2H2 438 460 2.2e-2 SMART
ZnF_C2H2 466 488 2.95e-3 SMART
ZnF_C2H2 494 516 4.24e-4 SMART
ZnF_C2H2 522 544 9.58e-3 SMART
ZnF_C2H2 550 572 4.01e-5 SMART
ZnF_C2H2 578 600 3.21e-4 SMART
ZnF_C2H2 606 628 4.87e-4 SMART
ZnF_C2H2 634 656 5.99e-4 SMART
ZnF_C2H2 662 684 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174489
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in abnormal skin pigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Zfp141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp141 APN 7 42475307 nonsense probably null
IGL00595:Zfp141 APN 7 42476655 missense probably benign 0.08
R0883:Zfp141 UTSW 7 42476056 missense possibly damaging 0.85
R1701:Zfp141 UTSW 7 42476046 missense probably benign 0.35
R2290:Zfp141 UTSW 7 42475225 missense probably damaging 1.00
R4176:Zfp141 UTSW 7 42476281 missense probably benign 0.04
R4719:Zfp141 UTSW 7 42476687 splice site probably null
R4897:Zfp141 UTSW 7 42476205 missense probably benign 0.24
R5372:Zfp141 UTSW 7 42477196 missense possibly damaging 0.91
R5438:Zfp141 UTSW 7 42489470 missense probably damaging 1.00
R5447:Zfp141 UTSW 7 42475559 nonsense probably null
R5743:Zfp141 UTSW 7 42476431 missense possibly damaging 0.68
R5969:Zfp141 UTSW 7 42489488 missense probably damaging 0.98
R6731:Zfp141 UTSW 7 42489500 missense probably damaging 0.99
R7127:Zfp141 UTSW 7 42475429 missense probably damaging 1.00
R7474:Zfp141 UTSW 7 42476254 nonsense probably null
R7572:Zfp141 UTSW 7 42475432 missense probably benign 0.03
R7830:Zfp141 UTSW 7 42475188 missense probably benign 0.01
R7890:Zfp141 UTSW 7 42476479 missense probably damaging 0.99
R7973:Zfp141 UTSW 7 42476479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACTGCTGGCTGCTTGTGGAC -3'
(R):5'- AGCGGGAGGCTCTTTTAGGAAAAC -3'

Sequencing Primer
(F):5'- GGCTATAATCCTGCTGGTACAAAG -3'
(R):5'- GGAAAACATTCCCGTCAGTCTTTG -3'
Posted On2013-07-11