Incidental Mutation 'R0577:Rps11'
ID56262
Institutional Source Beutler Lab
Gene Symbol Rps11
Ensembl Gene ENSMUSG00000003429
Gene Nameribosomal protein S11
Synonyms
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R0577 (G1)
Quality Score139
Status Validated
Chromosome7
Chromosomal Location45122379-45124439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45122850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000147630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003521] [ENSMUST00000150350] [ENSMUST00000209212] [ENSMUST00000209467] [ENSMUST00000209711] [ENSMUST00000209812] [ENSMUST00000209815] [ENSMUST00000211725] [ENSMUST00000210191] [ENSMUST00000210967] [ENSMUST00000211037] [ENSMUST00000210918] [ENSMUST00000209927] [ENSMUST00000210931]
Predicted Effect probably benign
Transcript: ENSMUST00000003521
AA Change: V111A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000003521
Gene: ENSMUSG00000003429
AA Change: V111A

DomainStartEndE-ValueType
Pfam:Ribosomal_S17_N 5 73 1.9e-40 PFAM
Pfam:Ribosomal_S17 75 144 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083944
Predicted Effect probably benign
Transcript: ENSMUST00000150350
SMART Domains Protein: ENSMUSP00000115722
Gene: ENSMUSG00000074129

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 6 122 7e-27 PFAM
low complexity region 169 180 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198528
Predicted Effect probably benign
Transcript: ENSMUST00000209212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209340
Predicted Effect probably benign
Transcript: ENSMUST00000209467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209626
Predicted Effect probably benign
Transcript: ENSMUST00000209711
Predicted Effect probably benign
Transcript: ENSMUST00000209812
Predicted Effect probably benign
Transcript: ENSMUST00000209815
Predicted Effect unknown
Transcript: ENSMUST00000209838
AA Change: V87A
Predicted Effect probably benign
Transcript: ENSMUST00000211725
AA Change: V111A

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000210191
Predicted Effect probably benign
Transcript: ENSMUST00000210967
Predicted Effect probably benign
Transcript: ENSMUST00000211037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210073
Predicted Effect probably benign
Transcript: ENSMUST00000210918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211494
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209967
Predicted Effect probably benign
Transcript: ENSMUST00000209927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211438
Predicted Effect probably benign
Transcript: ENSMUST00000210931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209965
Meta Mutation Damage Score 0.2760 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S17P family of ribosomal proteins that is a component of the 40S subunit. This gene is co-transcribed with the small nucleolar RNA gene U35B, which is located in the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Rps11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Rps11 APN 7 45123501 missense probably benign 0.03
IGL00848:Rps11 APN 7 45123501 missense probably benign 0.03
R0594:Rps11 UTSW 7 45124282 splice site probably benign
R4302:Rps11 UTSW 7 45122944 missense probably benign 0.05
R8722:Rps11 UTSW 7 45123192 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACATTGAATCGCACAGTCTTGCTC -3'
(R):5'- GCCAGTTGACAAAGCTGATGCC -3'

Sequencing Primer
(F):5'- AACTGTGACAATGTCTCCGATCTG -3'
(R):5'- GTTGACAAAGCTGATGCCATAAATG -3'
Posted On2013-07-11