Incidental Mutation 'R7233:Fscn1'
ID562624
Institutional Source Beutler Lab
Gene Symbol Fscn1
Ensembl Gene ENSMUSG00000029581
Gene Namefascin actin-bundling protein 1
SynonymsFan1, fascin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142960343-142973185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142970274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 366 (S366L)
Ref Sequence ENSEMBL: ENSMUSP00000031565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031565] [ENSMUST00000198017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031565
AA Change: S366L

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031565
Gene: ENSMUSG00000029581
AA Change: S366L

DomainStartEndE-ValueType
Pfam:Fascin 20 134 1.9e-37 PFAM
Pfam:Fascin 142 256 4.1e-30 PFAM
Pfam:Fascin 268 378 1.3e-36 PFAM
Pfam:Fascin 391 493 9.4e-24 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122862
Gene: ENSMUSG00000029581
AA Change: S113L

DomainStartEndE-ValueType
Pfam:Fascin 16 126 1.1e-37 PFAM
Pfam:Fascin 139 241 8.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000198017
AA Change: S205L

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142509
Gene: ENSMUSG00000029581
AA Change: S205L

DomainStartEndE-ValueType
Pfam:Fascin 20 74 2.3e-12 PFAM
Pfam:Fascin 107 217 7.3e-34 PFAM
Pfam:Fascin 230 332 1.5e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin family of actin-binding proteins. Fascin proteins organize F-actin into parallel bundles, and are required for the formation of actin-based cellular protrusions. The encoded protein plays a critical role in cell migration, motility, adhesion and cellular interactions. Expression of this gene is known to be regulated by several microRNAs, and overexpression of this gene may play a role in the metastasis of multiple types of cancer by increasing cell motility. Expression of this gene is also a marker for Reed-Sternberg cells in Hodgkin's lymphoma. A pseudogene of this gene is located on the long arm of chromosome 15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired migration of mature dendritic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Cfap44 T A 16: 44,422,408 L725Q probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Dopey1 G A 9: 86,521,696 A186T probably benign Het
Engase T A 11: 118,483,001 V323E probably damaging Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gfra4 A T 2: 131,041,117 V194E probably damaging Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pkdrej A G 15: 85,821,148 S196P probably damaging Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prmt7 A G 8: 106,220,010 T75A probably damaging Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Slc44a2 G T 9: 21,348,149 probably null Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Fscn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Fscn1 APN 5 142960620 missense possibly damaging 0.46
IGL02311:Fscn1 APN 5 142972010 missense probably benign 0.08
R0037:Fscn1 UTSW 5 142970694 splice site probably benign
R1163:Fscn1 UTSW 5 142960843 missense probably damaging 1.00
R1860:Fscn1 UTSW 5 142970063 critical splice donor site probably null
R4342:Fscn1 UTSW 5 142972021 missense probably damaging 1.00
R5569:Fscn1 UTSW 5 142961044 missense probably benign 0.13
R6248:Fscn1 UTSW 5 142961023 missense possibly damaging 0.94
R6517:Fscn1 UTSW 5 142971986 missense probably damaging 0.98
R6594:Fscn1 UTSW 5 142970028 missense probably benign 0.02
R6964:Fscn1 UTSW 5 142960660 missense probably damaging 1.00
R7000:Fscn1 UTSW 5 142960627 missense probably damaging 1.00
R7108:Fscn1 UTSW 5 142960515 missense probably damaging 1.00
R7165:Fscn1 UTSW 5 142972046 missense probably benign 0.13
R8030:Fscn1 UTSW 5 142961001 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGTACTGGACACTGACGG -3'
(R):5'- TCACAGCAACAAAGATGGGC -3'

Sequencing Primer
(F):5'- AGGTGTGCAATCCACTGC -3'
(R):5'- CCAGTCAGGGAATGGCTCAG -3'
Posted On2019-06-26