Incidental Mutation 'R7233:Prmt7'
ID562638
Institutional Source Beutler Lab
Gene Symbol Prmt7
Ensembl Gene ENSMUSG00000060098
Gene Nameprotein arginine N-methyltransferase 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106210936-106252794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106220010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Ref Sequence ENSEMBL: ENSMUSP00000071521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071592] [ENSMUST00000109296] [ENSMUST00000109297]
PDB Structure
Crystal structure of mouse protein arginine methyltransferase 7 in complex with SAH [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000071592
AA Change: T75A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071521
Gene: ENSMUSG00000060098
AA Change: T75A

DomainStartEndE-ValueType
Pfam:PrmA 53 148 1.6e-7 PFAM
internal_repeat_1 382 652 1.71e-8 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000109296
AA Change: T75A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104919
Gene: ENSMUSG00000060098
AA Change: T75A

DomainStartEndE-ValueType
Pfam:PrmA 6 113 5.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109297
AA Change: T75A

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104920
Gene: ENSMUSG00000060098
AA Change: T75A

DomainStartEndE-ValueType
Pfam:PrmA 51 148 1.5e-8 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119992
Gene: ENSMUSG00000060098
AA Change: T58A

DomainStartEndE-ValueType
Pfam:PrmA 37 132 3.2e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is an apparently irreversible protein modification catalyzed by arginine methyltransferases, such as PMT7, using S-adenosylmethionine (AdoMet) as the methyl donor. Arginine methylation is implicated in signal transduction, RNA transport, and RNA splicing (Miranda et al., 2004 [PubMed 15044439]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Cfap44 T A 16: 44,422,408 L725Q probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Dopey1 G A 9: 86,521,696 A186T probably benign Het
Engase T A 11: 118,483,001 V323E probably damaging Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Fscn1 C T 5: 142,970,274 S366L possibly damaging Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gfra4 A T 2: 131,041,117 V194E probably damaging Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pkdrej A G 15: 85,821,148 S196P probably damaging Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Slc44a2 G T 9: 21,348,149 probably null Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Prmt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Prmt7 APN 8 106237214 splice site probably benign
IGL01565:Prmt7 APN 8 106250409 missense probably damaging 0.97
IGL02245:Prmt7 APN 8 106237305 missense probably benign 0.10
R0104:Prmt7 UTSW 8 106237350 missense probably damaging 0.99
R0255:Prmt7 UTSW 8 106227207 splice site probably benign
R1432:Prmt7 UTSW 8 106237284 nonsense probably null
R1551:Prmt7 UTSW 8 106237382 missense probably benign
R1848:Prmt7 UTSW 8 106237008 missense probably benign
R2117:Prmt7 UTSW 8 106227298 missense probably damaging 0.96
R3784:Prmt7 UTSW 8 106242136 missense probably benign 0.01
R4599:Prmt7 UTSW 8 106250329 missense possibly damaging 0.80
R4940:Prmt7 UTSW 8 106237278 missense probably benign 0.01
R4983:Prmt7 UTSW 8 106250363 missense probably damaging 1.00
R5285:Prmt7 UTSW 8 106248359 missense probably benign 0.15
R6015:Prmt7 UTSW 8 106235008 intron probably benign
R6520:Prmt7 UTSW 8 106234884 missense probably damaging 1.00
R7097:Prmt7 UTSW 8 106235100 missense unknown
R7122:Prmt7 UTSW 8 106235100 missense unknown
R7538:Prmt7 UTSW 8 106237386 missense probably benign 0.02
R7577:Prmt7 UTSW 8 106242203 missense probably damaging 1.00
R7659:Prmt7 UTSW 8 106237286 missense probably benign 0.00
R7858:Prmt7 UTSW 8 106244688 missense possibly damaging 0.47
R7941:Prmt7 UTSW 8 106244688 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTGCTGACATCTAGAGGCTAC -3'
(R):5'- CTCCTGGAGAAAGGAACCCATC -3'

Sequencing Primer
(F):5'- CTGACATCTAGAGGCTACACAGG -3'
(R):5'- GGAACCCATCTGGCTCATC -3'
Posted On2019-06-26