Incidental Mutation 'R0577:Bag3'
ID56264
Institutional Source Beutler Lab
Gene Symbol Bag3
Ensembl Gene ENSMUSG00000030847
Gene NameBCL2-associated athanogene 3
SynonymsBcl-2-interacting death suppressor, Bis
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0577 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128523616-128546981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128523887 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 10 (M10T)
Ref Sequence ENSEMBL: ENSMUSP00000033136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033136]
PDB Structure
Solution structure of the Murine BAG domain of Bcl2-associated athanogene 3 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033136
AA Change: M10T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033136
Gene: ENSMUSG00000030847
AA Change: M10T

DomainStartEndE-ValueType
WW 23 56 1.49e-11 SMART
internal_repeat_1 90 151 3.37e-5 PROSPERO
low complexity region 158 171 N/A INTRINSIC
low complexity region 176 204 N/A INTRINSIC
internal_repeat_1 206 283 3.37e-5 PROSPERO
low complexity region 372 392 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
BAG 426 503 9.22e-27 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, growth retardation, cardiomyocyte and skeletal myocyte degeneration, and pulmonary edema. Mice homozygous for a null allele also exhibit postnatal lethality and growth retardation but lack the myocyte degeneration phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Bag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Bag3 APN 7 128546341 missense probably benign 0.03
IGL01942:Bag3 APN 7 128546300 missense probably benign 0.00
PIT4377001:Bag3 UTSW 7 128545717 missense probably damaging 1.00
R1730:Bag3 UTSW 7 128523859 start codon destroyed possibly damaging 0.89
R1991:Bag3 UTSW 7 128545683 missense probably benign
R2065:Bag3 UTSW 7 128545774 missense probably damaging 0.96
R2198:Bag3 UTSW 7 128545769 frame shift probably null
R2201:Bag3 UTSW 7 128545769 frame shift probably null
R3407:Bag3 UTSW 7 128545768 frame shift probably null
R3407:Bag3 UTSW 7 128545769 frame shift probably null
R3408:Bag3 UTSW 7 128545769 frame shift probably null
R3765:Bag3 UTSW 7 128540271 missense probably benign 0.30
R4201:Bag3 UTSW 7 128546157 missense probably damaging 1.00
R4430:Bag3 UTSW 7 128523923 missense probably damaging 0.99
R5642:Bag3 UTSW 7 128546106 missense probably damaging 1.00
R6112:Bag3 UTSW 7 128541832 missense probably damaging 0.99
R6298:Bag3 UTSW 7 128540198 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGGCTATTTCCAGACACTTCCAC -3'
(R):5'- CCGTTCGAGGCGGATATGGTTAAG -3'

Sequencing Primer
(F):5'- TCCAGACACTTCCACCCCTC -3'
(R):5'- CGGATATGGTTAAGGACTCTCC -3'
Posted On2013-07-11