Incidental Mutation 'R7233:Slc44a2'
ID562642
Institutional Source Beutler Lab
Gene Symbol Slc44a2
Ensembl Gene ENSMUSG00000057193
Gene Namesolute carrier family 44, member 2
Synonyms1110028E10Rik, CTL2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21320698-21355028 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 21348149 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034697] [ENSMUST00000215574] [ENSMUST00000217461]
Predicted Effect probably null
Transcript: ENSMUST00000034697
SMART Domains Protein: ENSMUSP00000034697
Gene: ENSMUSG00000057193

DomainStartEndE-ValueType
Blast:CLECT 4 37 8e-8 BLAST
transmembrane domain 231 253 N/A INTRINSIC
transmembrane domain 255 277 N/A INTRINSIC
Pfam:Choline_transpo 319 678 3.9e-119 PFAM
low complexity region 691 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213535
Predicted Effect probably null
Transcript: ENSMUST00000214268
Predicted Effect probably benign
Transcript: ENSMUST00000215574
Predicted Effect probably null
Transcript: ENSMUST00000217461
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cochlear hair cell loss, spiral ganglion degeneration, and progressive sensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Cfap44 T A 16: 44,422,408 L725Q probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Dopey1 G A 9: 86,521,696 A186T probably benign Het
Engase T A 11: 118,483,001 V323E probably damaging Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Fscn1 C T 5: 142,970,274 S366L possibly damaging Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gfra4 A T 2: 131,041,117 V194E probably damaging Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pkdrej A G 15: 85,821,148 S196P probably damaging Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prmt7 A G 8: 106,220,010 T75A probably damaging Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Slc44a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Slc44a2 APN 9 21345935 missense probably damaging 0.96
IGL01506:Slc44a2 APN 9 21337950 missense probably benign 0.30
IGL01687:Slc44a2 APN 9 21345947 missense probably benign 0.00
IGL01786:Slc44a2 APN 9 21352486 missense probably damaging 1.00
IGL01795:Slc44a2 APN 9 21345349 missense probably damaging 0.97
IGL02338:Slc44a2 APN 9 21347042 missense probably damaging 1.00
IGL02701:Slc44a2 APN 9 21347951 missense probably benign 0.01
IGL02820:Slc44a2 APN 9 21342977 missense probably benign
IGL03087:Slc44a2 APN 9 21346765 missense probably benign 0.00
IGL03153:Slc44a2 APN 9 21343200 missense probably benign 0.44
IGL03233:Slc44a2 APN 9 21348622 missense possibly damaging 0.95
Loaded UTSW 9 21348149 critical splice donor site probably null
R1177:Slc44a2 UTSW 9 21348583 missense probably benign 0.00
R1367:Slc44a2 UTSW 9 21343026 missense probably benign 0.00
R1474:Slc44a2 UTSW 9 21353694 missense probably damaging 0.99
R2077:Slc44a2 UTSW 9 21353724 missense probably damaging 1.00
R2432:Slc44a2 UTSW 9 21344834 missense probably damaging 1.00
R3722:Slc44a2 UTSW 9 21342977 missense possibly damaging 0.78
R3958:Slc44a2 UTSW 9 21348541 missense probably damaging 0.96
R4557:Slc44a2 UTSW 9 21346783 missense possibly damaging 0.93
R4641:Slc44a2 UTSW 9 21346882 missense probably damaging 1.00
R4725:Slc44a2 UTSW 9 21348395 missense probably damaging 1.00
R4859:Slc44a2 UTSW 9 21348145 missense probably damaging 0.98
R6701:Slc44a2 UTSW 9 21320853 critical splice donor site probably null
R7068:Slc44a2 UTSW 9 21320848 missense probably benign 0.00
R7206:Slc44a2 UTSW 9 21346807 missense probably damaging 1.00
R7287:Slc44a2 UTSW 9 21342456 missense probably benign
R7329:Slc44a2 UTSW 9 21342752 missense probably damaging 1.00
R7432:Slc44a2 UTSW 9 21343215 missense probably benign 0.00
R7442:Slc44a2 UTSW 9 21345523 missense probably damaging 1.00
R7448:Slc44a2 UTSW 9 21348346 missense possibly damaging 0.87
R7514:Slc44a2 UTSW 9 21342472 missense possibly damaging 0.46
R7523:Slc44a2 UTSW 9 21345992 missense probably null 0.81
X0018:Slc44a2 UTSW 9 21342788 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCATGGTGAACAGCAGGGC -3'
(R):5'- CAGAAGTTTGCCCAACAGGAAG -3'

Sequencing Primer
(F):5'- AGCAGGGCTGTATTGCTGC -3'
(R):5'- TAACTTTGTCCAGGACGGC -3'
Posted On2019-06-26