Incidental Mutation 'R7233:Dopey1'
ID562644
Institutional Source Beutler Lab
Gene Symbol Dopey1
Ensembl Gene ENSMUSG00000034973
Gene Namedopey family member 1
SynonymsB130005I07Rik, D9Ertd809e
MMRRC Submission
Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location86467154-86555923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86521696 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 186 (A186T)
Ref Sequence ENSEMBL: ENSMUSP00000140258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185297] [ENSMUST00000185919] [ENSMUST00000190957]
Predicted Effect probably benign
Transcript: ENSMUST00000034987
AA Change: A1650T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973
AA Change: A1650T

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185297
AA Change: A186T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140258
Gene: ENSMUSG00000034973
AA Change: A186T

DomainStartEndE-ValueType
low complexity region 111 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185919
AA Change: A1648T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973
AA Change: A1648T

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190957
AA Change: A1650T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973
AA Change: A1650T

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Cfap44 T A 16: 44,422,408 L725Q probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Engase T A 11: 118,483,001 V323E probably damaging Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Fscn1 C T 5: 142,970,274 S366L possibly damaging Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gfra4 A T 2: 131,041,117 V194E probably damaging Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pkdrej A G 15: 85,821,148 S196P probably damaging Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prmt7 A G 8: 106,220,010 T75A probably damaging Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Slc44a2 G T 9: 21,348,149 probably null Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Dopey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dopey1 APN 9 86551679 missense possibly damaging 0.57
IGL00427:Dopey1 APN 9 86521500 missense probably benign 0.09
IGL00427:Dopey1 APN 9 86521498 missense possibly damaging 0.93
IGL00427:Dopey1 APN 9 86521499 missense probably damaging 0.96
IGL00577:Dopey1 APN 9 86520946 missense probably damaging 1.00
IGL00741:Dopey1 APN 9 86522806 missense possibly damaging 0.50
IGL00959:Dopey1 APN 9 86487431 missense probably damaging 1.00
IGL01339:Dopey1 APN 9 86551677 missense possibly damaging 0.90
IGL01608:Dopey1 APN 9 86507561 missense probably benign 0.23
IGL01760:Dopey1 APN 9 86519923 missense probably benign
IGL01788:Dopey1 APN 9 86531719 missense probably benign 0.03
IGL01844:Dopey1 APN 9 86514085 missense probably damaging 1.00
IGL01923:Dopey1 APN 9 86522867 missense probably damaging 1.00
IGL02036:Dopey1 APN 9 86531765 missense probably benign 0.18
IGL02308:Dopey1 APN 9 86520088 missense probably damaging 0.98
IGL02494:Dopey1 APN 9 86526818 missense probably damaging 1.00
IGL02698:Dopey1 APN 9 86524359 splice site probably benign
IGL02731:Dopey1 APN 9 86487381 missense probably damaging 1.00
IGL02821:Dopey1 APN 9 86520156 missense probably benign
IGL02952:Dopey1 APN 9 86532922 splice site probably benign
IGL03071:Dopey1 APN 9 86489615 missense possibly damaging 0.91
IGL03271:Dopey1 APN 9 86504222 nonsense probably null
IGL03344:Dopey1 APN 9 86536144 missense probably damaging 1.00
Beg UTSW 9 86548172 nonsense probably null
groak UTSW 9 86521657 missense probably damaging 1.00
R0055:Dopey1 UTSW 9 86512652 missense probably benign 0.08
R0285:Dopey1 UTSW 9 86512639 missense probably damaging 1.00
R0415:Dopey1 UTSW 9 86506502 missense probably damaging 1.00
R0427:Dopey1 UTSW 9 86507532 missense probably damaging 1.00
R0514:Dopey1 UTSW 9 86520734 missense probably damaging 1.00
R0538:Dopey1 UTSW 9 86485497 missense probably damaging 1.00
R1118:Dopey1 UTSW 9 86515406 missense probably damaging 1.00
R1158:Dopey1 UTSW 9 86485556 missense probably damaging 1.00
R1272:Dopey1 UTSW 9 86521424 missense probably damaging 1.00
R1448:Dopey1 UTSW 9 86542732 splice site probably null
R1584:Dopey1 UTSW 9 86548172 nonsense probably null
R1601:Dopey1 UTSW 9 86536250 missense probably damaging 0.99
R1674:Dopey1 UTSW 9 86536160 missense probably damaging 0.98
R1706:Dopey1 UTSW 9 86554080 missense possibly damaging 0.92
R1856:Dopey1 UTSW 9 86492004 missense probably damaging 0.99
R1926:Dopey1 UTSW 9 86523019 missense probably damaging 1.00
R1929:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2029:Dopey1 UTSW 9 86521365 missense probably damaging 1.00
R2125:Dopey1 UTSW 9 86521046 missense probably damaging 1.00
R2206:Dopey1 UTSW 9 86521599 missense probably benign 0.00
R2271:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2312:Dopey1 UTSW 9 86521442 nonsense probably null
R2379:Dopey1 UTSW 9 86521085 missense probably damaging 1.00
R2507:Dopey1 UTSW 9 86513117 missense probably damaging 1.00
R3737:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R3804:Dopey1 UTSW 9 86520995 missense probably damaging 1.00
R3916:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R3921:Dopey1 UTSW 9 86520271 missense probably benign 0.06
R4035:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R4392:Dopey1 UTSW 9 86503143 intron probably benign
R4404:Dopey1 UTSW 9 86522813 nonsense probably null
R4513:Dopey1 UTSW 9 86520559 missense probably benign 0.39
R4624:Dopey1 UTSW 9 86521525 missense probably damaging 1.00
R4659:Dopey1 UTSW 9 86502032 intron probably benign
R4910:Dopey1 UTSW 9 86492061 missense probably damaging 1.00
R4919:Dopey1 UTSW 9 86520056 missense possibly damaging 0.47
R5061:Dopey1 UTSW 9 86503108 splice site probably benign
R5079:Dopey1 UTSW 9 86487421 missense probably damaging 1.00
R5118:Dopey1 UTSW 9 86506259 missense probably damaging 1.00
R5169:Dopey1 UTSW 9 86533021 missense probably damaging 1.00
R5176:Dopey1 UTSW 9 86521815 missense probably damaging 1.00
R5190:Dopey1 UTSW 9 86487304 missense probably damaging 1.00
R5256:Dopey1 UTSW 9 86515328 missense probably damaging 1.00
R5346:Dopey1 UTSW 9 86520782 missense probably damaging 1.00
R5484:Dopey1 UTSW 9 86545288 missense probably damaging 1.00
R5501:Dopey1 UTSW 9 86507730 missense probably benign 0.04
R5554:Dopey1 UTSW 9 86521657 missense probably damaging 1.00
R5707:Dopey1 UTSW 9 86502997 missense possibly damaging 0.95
R5826:Dopey1 UTSW 9 86507570 missense possibly damaging 0.94
R5921:Dopey1 UTSW 9 86501922 missense probably damaging 1.00
R5934:Dopey1 UTSW 9 86542442 nonsense probably null
R5936:Dopey1 UTSW 9 86536512 nonsense probably null
R6046:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R6053:Dopey1 UTSW 9 86515294 missense possibly damaging 0.95
R6072:Dopey1 UTSW 9 86507697 missense probably benign 0.00
R6104:Dopey1 UTSW 9 86520807 missense possibly damaging 0.86
R6125:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R6299:Dopey1 UTSW 9 86504212 missense probably damaging 1.00
R6930:Dopey1 UTSW 9 86531772 critical splice donor site probably null
R6949:Dopey1 UTSW 9 86500860 missense probably damaging 1.00
R6979:Dopey1 UTSW 9 86521642 missense possibly damaging 0.77
R7035:Dopey1 UTSW 9 86524302 missense possibly damaging 0.85
R7069:Dopey1 UTSW 9 86550169 critical splice donor site probably null
R7101:Dopey1 UTSW 9 86507669 missense probably benign
R7202:Dopey1 UTSW 9 86504167 splice site probably null
R7222:Dopey1 UTSW 9 86522876 critical splice donor site probably null
R7236:Dopey1 UTSW 9 86515378 missense probably damaging 1.00
R7252:Dopey1 UTSW 9 86500821 missense probably damaging 1.00
R7268:Dopey1 UTSW 9 86512777 nonsense probably null
R7353:Dopey1 UTSW 9 86512859 missense probably damaging 0.99
R7481:Dopey1 UTSW 9 86535932 missense probably damaging 1.00
R7498:Dopey1 UTSW 9 86494411 missense possibly damaging 0.95
R7507:Dopey1 UTSW 9 86535949 missense probably benign 0.01
R7525:Dopey1 UTSW 9 86506290 missense probably damaging 1.00
R7539:Dopey1 UTSW 9 86521573 missense probably benign 0.03
R7751:Dopey1 UTSW 9 86507730 missense probably benign 0.00
R7753:Dopey1 UTSW 9 86489702 missense possibly damaging 0.52
R7839:Dopey1 UTSW 9 86542765 nonsense probably null
R7868:Dopey1 UTSW 9 86501984 critical splice donor site probably null
R7922:Dopey1 UTSW 9 86542765 nonsense probably null
R7951:Dopey1 UTSW 9 86501984 critical splice donor site probably null
R8061:Dopey1 UTSW 9 86521193 missense possibly damaging 0.95
R8067:Dopey1 UTSW 9 86518339 missense probably benign 0.00
RF004:Dopey1 UTSW 9 86554191 missense probably benign
X0019:Dopey1 UTSW 9 86506227 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86531750 missense probably damaging 0.98
ZE80:Dopey1 UTSW 9 86500842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACGTGATGACTATTCCTGAG -3'
(R):5'- AGTCCTTATCTACCAGATAACTGTG -3'

Sequencing Primer
(F):5'- CGTGATGACTATTCCTGAGGAGAATG -3'
(R):5'- TGCTAAATTAGTGTCCAACTTGAC -3'
Posted On2019-06-26