Incidental Mutation 'R0577:Aars1'
ID 56265
Institutional Source Beutler Lab
Gene Symbol Aars1
Ensembl Gene ENSMUSG00000031960
Gene Name alanyl-tRNA synthetase 1
Synonyms Aars
MMRRC Submission 038767-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R0577 (G1)
Quality Score 204
Status Validated
Chromosome 8
Chromosomal Location 111759781-111784237 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111769910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 336 (H336Q)
Ref Sequence ENSEMBL: ENSMUSP00000034441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034441]
AlphaFold Q8BGQ7
Predicted Effect probably benign
Transcript: ENSMUST00000034441
AA Change: H336Q

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: H336Q

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 9 597 9.2e-228 PFAM
tRNA_SAD 694 753 5.97e-18 SMART
Pfam:DHHA1 885 957 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174930
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,807,840 (GRCm39) D827V probably damaging Het
Asph G T 4: 9,604,620 (GRCm39) A139E probably benign Het
Bag3 T C 7: 128,125,611 (GRCm39) M10T probably benign Het
Bod1l T C 5: 41,952,230 (GRCm39) D2894G probably damaging Het
Cdk12 T C 11: 98,094,332 (GRCm39) S47P probably damaging Het
Dchs1 C T 7: 105,413,462 (GRCm39) V1118I possibly damaging Het
Ddi2 A T 4: 141,411,818 (GRCm39) C365S possibly damaging Het
Eef1g A G 19: 8,950,406 (GRCm39) D264G probably benign Het
Fbxw17 T C 13: 50,585,619 (GRCm39) L274P probably benign Het
Gpc6 A G 14: 117,673,420 (GRCm39) T226A probably benign Het
Klf12 T A 14: 100,260,585 (GRCm39) Y48F probably damaging Het
Klhdc4 C T 8: 122,548,090 (GRCm39) A67T probably damaging Het
Macir C T 1: 97,589,551 (GRCm39) probably null Het
Madd C T 2: 90,968,740 (GRCm39) E1596K possibly damaging Het
Mov10l1 A G 15: 88,889,930 (GRCm39) Y533C probably damaging Het
Mtif2 G T 11: 29,490,862 (GRCm39) probably null Het
Mtmr6 G A 14: 60,534,087 (GRCm39) V442I possibly damaging Het
Or4k15b C T 14: 50,272,249 (GRCm39) G204R probably damaging Het
Or5ac23 A T 16: 59,149,061 (GRCm39) D270E probably benign Het
Or9i16 T C 19: 13,865,167 (GRCm39) T136A probably damaging Het
Pdcd11 A G 19: 47,087,271 (GRCm39) N277S probably benign Het
Pias2 A T 18: 77,184,977 (GRCm39) L12F probably damaging Het
Potefam1 G T 2: 111,024,694 (GRCm39) Q57K probably benign Het
Rnf213 G T 11: 119,334,106 (GRCm39) R3105L probably damaging Het
Rps11 A G 7: 44,772,274 (GRCm39) V111A probably benign Het
Rrs1 C A 1: 9,616,026 (GRCm39) probably null Het
Thsd7a T C 6: 12,321,047 (GRCm39) T1543A possibly damaging Het
Vmn2r86 C A 10: 130,288,444 (GRCm39) R352S probably benign Het
Zfp141 T C 7: 42,125,938 (GRCm39) N178S probably benign Het
Zfp955a A T 17: 33,461,068 (GRCm39) F355I probably damaging Het
Other mutations in Aars1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Aars1 APN 8 111,774,604 (GRCm39) missense possibly damaging 0.86
IGL00731:Aars1 APN 8 111,771,501 (GRCm39) splice site probably benign
IGL00826:Aars1 APN 8 111,766,932 (GRCm39) missense probably damaging 1.00
IGL01521:Aars1 APN 8 111,770,419 (GRCm39) missense possibly damaging 0.85
IGL01885:Aars1 APN 8 111,774,575 (GRCm39) missense possibly damaging 0.89
IGL01920:Aars1 APN 8 111,769,878 (GRCm39) missense probably damaging 1.00
IGL01934:Aars1 APN 8 111,774,650 (GRCm39) missense probably damaging 0.98
IGL02013:Aars1 APN 8 111,773,698 (GRCm39) missense probably damaging 0.99
IGL02489:Aars1 APN 8 111,780,847 (GRCm39) unclassified probably benign
IGL02683:Aars1 APN 8 111,779,163 (GRCm39) unclassified probably benign
IGL03084:Aars1 APN 8 111,768,261 (GRCm39) missense probably damaging 1.00
H8786:Aars1 UTSW 8 111,772,187 (GRCm39) missense probably benign
R0037:Aars1 UTSW 8 111,769,891 (GRCm39) missense possibly damaging 0.77
R0049:Aars1 UTSW 8 111,779,083 (GRCm39) missense possibly damaging 0.75
R0049:Aars1 UTSW 8 111,779,083 (GRCm39) missense possibly damaging 0.75
R1183:Aars1 UTSW 8 111,768,206 (GRCm39) nonsense probably null
R1642:Aars1 UTSW 8 111,769,882 (GRCm39) missense possibly damaging 0.77
R1829:Aars1 UTSW 8 111,769,338 (GRCm39) missense probably damaging 1.00
R1857:Aars1 UTSW 8 111,766,789 (GRCm39) missense probably damaging 0.99
R2190:Aars1 UTSW 8 111,766,785 (GRCm39) missense probably damaging 1.00
R2303:Aars1 UTSW 8 111,779,134 (GRCm39) missense possibly damaging 0.84
R3918:Aars1 UTSW 8 111,766,774 (GRCm39) missense probably damaging 1.00
R4001:Aars1 UTSW 8 111,768,234 (GRCm39) missense probably damaging 1.00
R4434:Aars1 UTSW 8 111,781,253 (GRCm39) missense probably null 0.74
R4909:Aars1 UTSW 8 111,781,715 (GRCm39) missense probably damaging 1.00
R4970:Aars1 UTSW 8 111,770,311 (GRCm39) missense probably benign 0.00
R5639:Aars1 UTSW 8 111,769,866 (GRCm39) missense probably benign 0.01
R5991:Aars1 UTSW 8 111,777,032 (GRCm39) missense probably damaging 1.00
R6403:Aars1 UTSW 8 111,768,881 (GRCm39) missense possibly damaging 0.87
R6521:Aars1 UTSW 8 111,769,968 (GRCm39) missense probably benign 0.01
R6956:Aars1 UTSW 8 111,781,762 (GRCm39) missense probably benign 0.38
R7378:Aars1 UTSW 8 111,768,974 (GRCm39) missense probably damaging 1.00
R7625:Aars1 UTSW 8 111,773,587 (GRCm39) missense probably damaging 0.99
R7745:Aars1 UTSW 8 111,768,289 (GRCm39) missense probably damaging 1.00
R7792:Aars1 UTSW 8 111,769,896 (GRCm39) missense possibly damaging 0.75
R7860:Aars1 UTSW 8 111,776,493 (GRCm39) missense probably benign 0.16
R8109:Aars1 UTSW 8 111,767,284 (GRCm39) missense probably benign
R8197:Aars1 UTSW 8 111,780,628 (GRCm39) missense probably benign 0.44
R8322:Aars1 UTSW 8 111,772,160 (GRCm39) missense possibly damaging 0.93
R8343:Aars1 UTSW 8 111,767,361 (GRCm39) missense probably damaging 1.00
R8683:Aars1 UTSW 8 111,768,881 (GRCm39) missense possibly damaging 0.87
R8783:Aars1 UTSW 8 111,776,515 (GRCm39) missense probably benign 0.01
R8977:Aars1 UTSW 8 111,766,849 (GRCm39) missense probably damaging 1.00
R9087:Aars1 UTSW 8 111,768,169 (GRCm39) missense probably damaging 1.00
R9401:Aars1 UTSW 8 111,780,785 (GRCm39) missense probably benign 0.24
R9561:Aars1 UTSW 8 111,763,615 (GRCm39) missense probably damaging 1.00
R9576:Aars1 UTSW 8 111,768,296 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTGCATTCCTGACTAGGCAGGC -3'
(R):5'- AGGCTATTCCGTGAAACACCCTCC -3'

Sequencing Primer
(F):5'- GCTTGGGTAGCTAAACAAACTCTC -3'
(R):5'- gcctcaaactcatctgcctc -3'
Posted On 2013-07-11