Incidental Mutation 'R0577:Aars'
ID56265
Institutional Source Beutler Lab
Gene Symbol Aars
Ensembl Gene ENSMUSG00000031960
Gene Namealanyl-tRNA synthetase
Synonyms
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R0577 (G1)
Quality Score204
Status Validated
Chromosome8
Chromosomal Location111033144-111057664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111043278 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 336 (H336Q)
Ref Sequence ENSEMBL: ENSMUSP00000034441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034441]
Predicted Effect probably benign
Transcript: ENSMUST00000034441
AA Change: H336Q

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: H336Q

DomainStartEndE-ValueType
Pfam:tRNA-synt_2c 9 597 9.2e-228 PFAM
tRNA_SAD 694 753 5.97e-18 SMART
Pfam:DHHA1 885 957 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174930
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Aars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Aars APN 8 111047972 missense possibly damaging 0.86
IGL00731:Aars APN 8 111044869 splice site probably benign
IGL00826:Aars APN 8 111040300 missense probably damaging 1.00
IGL01521:Aars APN 8 111043787 missense possibly damaging 0.85
IGL01885:Aars APN 8 111047943 missense possibly damaging 0.89
IGL01920:Aars APN 8 111043246 missense probably damaging 1.00
IGL01934:Aars APN 8 111048018 missense probably damaging 0.98
IGL02013:Aars APN 8 111047066 missense probably damaging 0.99
IGL02489:Aars APN 8 111054215 unclassified probably benign
IGL02683:Aars APN 8 111052531 unclassified probably benign
IGL03084:Aars APN 8 111041629 missense probably damaging 1.00
H8786:Aars UTSW 8 111045555 missense probably benign
R0037:Aars UTSW 8 111043259 missense possibly damaging 0.77
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R0049:Aars UTSW 8 111052451 missense possibly damaging 0.75
R1183:Aars UTSW 8 111041574 nonsense probably null
R1642:Aars UTSW 8 111043250 missense possibly damaging 0.77
R1829:Aars UTSW 8 111042706 missense probably damaging 1.00
R1857:Aars UTSW 8 111040157 missense probably damaging 0.99
R2190:Aars UTSW 8 111040153 missense probably damaging 1.00
R2303:Aars UTSW 8 111052502 missense possibly damaging 0.84
R3918:Aars UTSW 8 111040142 missense probably damaging 1.00
R4001:Aars UTSW 8 111041602 missense probably damaging 1.00
R4434:Aars UTSW 8 111054621 missense probably null 0.74
R4909:Aars UTSW 8 111055083 missense probably damaging 1.00
R4970:Aars UTSW 8 111043679 missense probably benign 0.00
R5639:Aars UTSW 8 111043234 missense probably benign 0.01
R5991:Aars UTSW 8 111050400 missense probably damaging 1.00
R6403:Aars UTSW 8 111042249 missense possibly damaging 0.87
R6521:Aars UTSW 8 111043336 missense probably benign 0.01
R6956:Aars UTSW 8 111055130 missense probably benign 0.38
R7378:Aars UTSW 8 111042342 missense probably damaging 1.00
R7625:Aars UTSW 8 111046955 missense probably damaging 0.99
R7745:Aars UTSW 8 111041657 missense probably damaging 1.00
R7792:Aars UTSW 8 111043264 missense possibly damaging 0.75
R7860:Aars UTSW 8 111049861 missense probably benign 0.16
R7943:Aars UTSW 8 111049861 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACTGCATTCCTGACTAGGCAGGC -3'
(R):5'- AGGCTATTCCGTGAAACACCCTCC -3'

Sequencing Primer
(F):5'- GCTTGGGTAGCTAAACAAACTCTC -3'
(R):5'- gcctcaaactcatctgcctc -3'
Posted On2013-07-11