Incidental Mutation 'R7233:Engase'
ID562656
Institutional Source Beutler Lab
Gene Symbol Engase
Ensembl Gene ENSMUSG00000033857
Gene Nameendo-beta-N-acetylglucosaminidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location118476829-118489209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118483001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 323 (V323E)
Ref Sequence ENSEMBL: ENSMUSP00000117538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043447] [ENSMUST00000135383] [ENSMUST00000139917] [ENSMUST00000166995] [ENSMUST00000168689] [ENSMUST00000171769] [ENSMUST00000172279]
Predicted Effect probably benign
Transcript: ENSMUST00000043447
Predicted Effect probably damaging
Transcript: ENSMUST00000135383
AA Change: V323E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117538
Gene: ENSMUSG00000033857
AA Change: V323E

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Glyco_hydro_85 127 404 2.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139917
SMART Domains Protein: ENSMUSP00000129698
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166995
SMART Domains Protein: ENSMUSP00000127862
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168689
SMART Domains Protein: ENSMUSP00000125886
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
PDB:3FHA|D 13 143 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171769
SMART Domains Protein: ENSMUSP00000132734
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172279
Meta Mutation Damage Score 0.6717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme which catalyzes the hydrolysis of peptides and proteins with mannose modifications to produce free oligosaccharides. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozgyous for knock-out alleles of this gene and Ngly1 exhibit restored endoplasmic reticulum (ER)-associated degradation (ERAD) process compared with MEFs lacking only Ngly1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Cfap44 T A 16: 44,422,408 L725Q probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Dopey1 G A 9: 86,521,696 A186T probably benign Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Fscn1 C T 5: 142,970,274 S366L possibly damaging Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gfra4 A T 2: 131,041,117 V194E probably damaging Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pkdrej A G 15: 85,821,148 S196P probably damaging Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prmt7 A G 8: 106,220,010 T75A probably damaging Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Slc44a2 G T 9: 21,348,149 probably null Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Engase
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Engase APN 11 118482970 missense possibly damaging 0.91
IGL00963:Engase APN 11 118482998 missense probably damaging 1.00
IGL02652:Engase APN 11 118478950 missense probably damaging 0.99
R0135:Engase UTSW 11 118484478 missense possibly damaging 0.68
R1337:Engase UTSW 11 118482574 missense possibly damaging 0.46
R1435:Engase UTSW 11 118484901 missense probably damaging 1.00
R1515:Engase UTSW 11 118487140 missense possibly damaging 0.53
R1889:Engase UTSW 11 118478933 missense probably damaging 1.00
R1939:Engase UTSW 11 118479186 missense probably damaging 1.00
R4628:Engase UTSW 11 118484905 missense probably damaging 1.00
R4730:Engase UTSW 11 118482922 missense probably damaging 1.00
R4762:Engase UTSW 11 118487094 missense possibly damaging 0.89
R4775:Engase UTSW 11 118482671 missense probably benign 0.22
R5155:Engase UTSW 11 118481281 missense probably benign 0.25
R5271:Engase UTSW 11 118481397 missense probably damaging 0.99
R5688:Engase UTSW 11 118487320 missense possibly damaging 0.91
R6659:Engase UTSW 11 118481316 missense probably benign 0.07
R7104:Engase UTSW 11 118481295 missense probably damaging 0.98
R8047:Engase UTSW 11 118486456 missense probably benign
Z1177:Engase UTSW 11 118485757 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTGTGCCTGTGAGCATCAG -3'
(R):5'- CCTATGGGAAATGATACATGGGTGG -3'

Sequencing Primer
(F):5'- CTGTGAGCATCAGGGAGGC -3'
(R):5'- ACAGGATCCTTGCCTGTGACTG -3'
Posted On2019-06-26