Incidental Mutation 'R7233:Pkdrej'
ID562661
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85821148 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 196 (S196P)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably damaging
Transcript: ENSMUST00000064370
AA Change: S196P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: S196P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Cfap44 T A 16: 44,422,408 L725Q probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Dopey1 G A 9: 86,521,696 A186T probably benign Het
Engase T A 11: 118,483,001 V323E probably damaging Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Fscn1 C T 5: 142,970,274 S366L possibly damaging Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gfra4 A T 2: 131,041,117 V194E probably damaging Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prmt7 A G 8: 106,220,010 T75A probably damaging Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Slc44a2 G T 9: 21,348,149 probably null Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R7956:Pkdrej UTSW 15 85816523 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAACTGGAGTCCCCATGTGG -3'
(R):5'- TCAATATCACTGTGCGTTGGTACTG -3'

Sequencing Primer
(F):5'- CCATGTGGGGATGTCTGCCTC -3'
(R):5'- CGTTGGTACTGTCCTGATGCC -3'
Posted On2019-06-26