Incidental Mutation 'R7233:Cfap44'
ID562663
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7233 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44422408 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 725 (L725Q)
Ref Sequence ENSEMBL: ENSMUSP00000097331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect probably damaging
Transcript: ENSMUST00000099742
AA Change: L725Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: L725Q

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120049
AA Change: L725Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: L725Q

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
8030462N17Rik C A 18: 77,635,186 V385F probably damaging Het
Acox3 A G 5: 35,605,297 K505R probably benign Het
Arhgap24 A G 5: 102,878,501 K263E probably benign Het
Armc2 A T 10: 41,923,804 V686D probably damaging Het
Bhmt T A 13: 93,621,517 K229* probably null Het
Birc2 A T 9: 7,827,008 C326S probably damaging Het
Blzf1 A T 1: 164,295,943 probably null Het
Camsap3 T A 8: 3,600,371 F223Y probably damaging Het
Ccdc126 C T 6: 49,339,841 T85M probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2h T A 8: 105,017,456 C279S probably damaging Het
Clip1 T C 5: 123,611,859 E987G probably damaging Het
Cog1 G T 11: 113,649,730 R57L probably damaging Het
Ctdspl T C 9: 119,020,046 probably null Het
Dnttip2 T C 3: 122,276,390 V418A probably benign Het
Dopey1 G A 9: 86,521,696 A186T probably benign Het
Engase T A 11: 118,483,001 V323E probably damaging Het
Fam92b A G 8: 120,171,922 L131P probably damaging Het
Farsb A G 1: 78,471,081 probably null Het
Fpr2 G T 17: 17,893,504 W254L probably damaging Het
Frmd3 A C 4: 74,013,786 H6P probably benign Het
Fscn1 C T 5: 142,970,274 S366L possibly damaging Het
Galt T A 4: 41,758,267 I344N probably benign Het
Gfra4 A T 2: 131,041,117 V194E probably damaging Het
Gm11639 T C 11: 104,839,843 S1966P possibly damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm3139 A T 5: 94,537,665 M395L probably benign Het
Golgb1 T C 16: 36,914,758 S1497P possibly damaging Het
Igfn1 A C 1: 135,970,135 S898A probably benign Het
Igkv1-135 T C 6: 67,610,348 S68P probably benign Het
Lama2 A T 10: 27,231,663 C784S probably damaging Het
Lars2 G T 9: 123,411,954 G229* probably null Het
Lats2 A T 14: 57,722,694 probably null Het
Lgr6 A C 1: 135,000,476 probably null Het
Lrp1 A T 10: 127,595,061 I373N probably damaging Het
Maml2 A T 9: 13,620,771 H427L Het
Mansc1 A G 6: 134,621,843 V37A probably damaging Het
Map4k3 A G 17: 80,597,648 V738A possibly damaging Het
Mastl A G 2: 23,133,658 I351T probably benign Het
Mcmdc2 T G 1: 9,932,183 probably null Het
Mrgprd A G 7: 145,321,935 D181G possibly damaging Het
Msra T C 14: 64,123,265 Y209C probably damaging Het
Musk A G 4: 58,373,307 E759G possibly damaging Het
Nab1 T C 1: 52,459,219 *487W probably null Het
Olfr373 A G 8: 72,100,056 T99A probably benign Het
Olfr490 T A 7: 108,286,716 T137S probably benign Het
Pkdrej A G 15: 85,821,148 S196P probably damaging Het
Pln A G 10: 53,343,912 T17A probably damaging Het
Polrmt A T 10: 79,745,785 probably null Het
Ppp1r14a T A 7: 29,289,524 Y64N probably damaging Het
Ppp1r9a A T 6: 5,134,804 H959L probably benign Het
Prmt7 A G 8: 106,220,010 T75A probably damaging Het
Prom1 T C 5: 44,037,474 S319G possibly damaging Het
Prtg G A 9: 72,911,991 G1089S probably benign Het
Ptprd T C 4: 76,059,783 D596G probably benign Het
Rbm12 C T 2: 156,095,974 G793S unknown Het
Rora A T 9: 69,197,522 R43* probably null Het
Sez6 T C 11: 77,973,137 Y482H probably damaging Het
Skint2 A T 4: 112,625,925 N176Y probably damaging Het
Slc44a2 G T 9: 21,348,149 probably null Het
Sox6 A G 7: 115,489,809 V606A possibly damaging Het
Spa17 T C 9: 37,603,291 probably null Het
Syne1 A C 10: 5,302,160 L2498R probably damaging Het
Synpo2 T G 3: 123,117,684 H104P probably benign Het
Tapbp G T 17: 33,919,969 A46S probably damaging Het
Tbc1d30 C A 10: 121,272,057 R480L probably benign Het
Tshz1 T C 18: 84,014,819 D488G possibly damaging Het
Ulk1 A G 5: 110,809,042 L70P probably damaging Het
Zcchc17 T A 4: 130,327,323 D145V probably damaging Het
Zfp318 T A 17: 46,406,052 L1037M probably damaging Het
Zfp324 C T 7: 12,970,597 Q238* probably null Het
Zfp874a A G 13: 67,442,657 Y303H possibly damaging Het
Zfp975 T C 7: 42,662,494 K232E probably benign Het
Zfp982 T A 4: 147,513,261 N358K probably benign Het
Zmiz1 C T 14: 25,649,668 P417S possibly damaging Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7294:Cfap44 UTSW 16 44404893 intron probably benign
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7455:Cfap44 UTSW 16 44404784 intron probably benign
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7491:Cfap44 UTSW 16 44470748 missense probably damaging 1.00
R7587:Cfap44 UTSW 16 44404106 missense probably benign 0.02
R7698:Cfap44 UTSW 16 44433786 missense probably damaging 0.99
R7717:Cfap44 UTSW 16 44429935 missense probably damaging 0.97
R8043:Cfap44 UTSW 16 44413691 missense probably benign 0.00
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Z1177:Cfap44 UTSW 16 44432044 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAATCTTTGTCATGCTCACACAC -3'
(R):5'- GAGTTAGGCCTTGAATGACAACAG -3'

Sequencing Primer
(F):5'- TTTGTCATGCTCACACACAAAATAAC -3'
(R):5'- GCCTTGAATGACAACAGATACAAAAG -3'
Posted On2019-06-26