Incidental Mutation 'R7234:Sec16a'
ID562676
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26439768 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 745 (T745K)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably damaging
Transcript: ENSMUST00000091252
AA Change: T745K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: T745K

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114082
AA Change: T745K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: T745K

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153996
SMART Domains Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 12 29 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
low complexity region 154 170 N/A INTRINSIC
low complexity region 205 215 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6860:Sec16a UTSW 2 26430112 missense probably damaging 1.00
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
R7414:Sec16a UTSW 2 26423631 missense
R7417:Sec16a UTSW 2 26421397 missense
R7501:Sec16a UTSW 2 26441851 missense probably damaging 1.00
R7558:Sec16a UTSW 2 26439734 missense
R7696:Sec16a UTSW 2 26415633 critical splice donor site probably null
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Z1176:Sec16a UTSW 2 26438748 missense
Z1177:Sec16a UTSW 2 26439321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGGTTCTGCAAAGGTGGC -3'
(R):5'- ACCACCTGATGCTACCTCAG -3'

Sequencing Primer
(F):5'- AGGTGGCACAGACCCTTGTTTC -3'
(R):5'- CCTGATGCTACCTCAGGAAAC -3'
Posted On2019-06-26