Incidental Mutation 'R0577:Mtif2'
ID56268
Institutional Source Beutler Lab
Gene Symbol Mtif2
Ensembl Gene ENSMUSG00000020459
Gene Namemitochondrial translational initiation factor 2
Synonyms2310038D14Rik, 2410112O06Rik, IF-2mt
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0577 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29526408-29545279 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 29540862 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020749] [ENSMUST00000093239] [ENSMUST00000102844] [ENSMUST00000102845] [ENSMUST00000144321]
Predicted Effect probably null
Transcript: ENSMUST00000020749
SMART Domains Protein: ENSMUSP00000020749
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093239
SMART Domains Protein: ENSMUSP00000090926
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102844
SMART Domains Protein: ENSMUSP00000099908
Gene: ENSMUSG00000020460

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_S27 101 147 9.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102845
SMART Domains Protein: ENSMUSP00000099909
Gene: ENSMUSG00000020460

DomainStartEndE-ValueType
UBQ 1 72 2.14e-36 SMART
Pfam:Ribosomal_S27 102 147 1.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129893
Predicted Effect probably benign
Transcript: ENSMUST00000132783
SMART Domains Protein: ENSMUSP00000121327
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
PDB:3IZY|P 47 247 8e-92 PDB
SCOP:d1g7sa1 163 244 2e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144321
SMART Domains Protein: ENSMUSP00000114299
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
Pfam:Arf 175 341 1.1e-5 PFAM
Pfam:SRPRB 178 310 1.5e-6 PFAM
Pfam:GTP_EFTU 178 344 3.8e-39 PFAM
Pfam:MMR_HSR1 182 289 1.1e-8 PFAM
Pfam:Miro 182 291 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147782
Meta Mutation Damage Score 0.9581 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] During the initiation of protein biosynthesis, initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide, while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt), an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s, with the greatest degree of conservation in the G domains of the proteins. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Mtif2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mtif2 APN 11 29538753 missense probably damaging 1.00
IGL01020:Mtif2 APN 11 29544973 missense possibly damaging 0.61
IGL01323:Mtif2 APN 11 29541447 missense probably damaging 0.98
IGL01360:Mtif2 APN 11 29530110 missense probably benign 0.00
IGL01744:Mtif2 APN 11 29544417 unclassified probably benign
IGL01757:Mtif2 APN 11 29541337 unclassified probably benign
IGL02247:Mtif2 APN 11 29540642 missense possibly damaging 0.65
IGL02642:Mtif2 APN 11 29544395 missense probably benign
IGL03093:Mtif2 APN 11 29530702 splice site probably benign
R0418:Mtif2 UTSW 11 29533401 splice site probably benign
R0554:Mtif2 UTSW 11 29533398 critical splice donor site probably null
R1159:Mtif2 UTSW 11 29540729 missense possibly damaging 0.95
R1168:Mtif2 UTSW 11 29536914 missense probably benign 0.11
R1344:Mtif2 UTSW 11 29545002 missense probably benign
R1418:Mtif2 UTSW 11 29545002 missense probably benign
R1482:Mtif2 UTSW 11 29536847 missense probably damaging 1.00
R1657:Mtif2 UTSW 11 29540721 missense probably benign 0.00
R1850:Mtif2 UTSW 11 29540683 missense probably benign 0.03
R3692:Mtif2 UTSW 11 29540718 missense probably benign 0.03
R4471:Mtif2 UTSW 11 29540053 splice site probably benign
R4730:Mtif2 UTSW 11 29540834 missense probably benign 0.00
R5248:Mtif2 UTSW 11 29536889 missense probably damaging 1.00
R5343:Mtif2 UTSW 11 29536964 missense probably damaging 1.00
R5989:Mtif2 UTSW 11 29530098 missense probably damaging 0.96
R6511:Mtif2 UTSW 11 29536949 missense possibly damaging 0.81
R7209:Mtif2 UTSW 11 29529996 missense probably benign 0.00
R7318:Mtif2 UTSW 11 29540115 missense probably benign 0.25
X0064:Mtif2 UTSW 11 29538760 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGCCCGTGAAGTTATTGAATGGAGG -3'
(R):5'- TCAATTAAGGATTTACTGGGGCAGTGC -3'

Sequencing Primer
(F):5'- TTATTGAATGGAGGAAGTCTGAGC -3'
(R):5'- ACCTGGACATTTATAGGCTAGGC -3'
Posted On2013-07-11