Incidental Mutation 'R7234:Csmd2'
ID 562685
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R7234 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 127987857-128567656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128456779 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1547 (Y1547C)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8913:Csmd2 UTSW 4 128523558 missense
R8928:Csmd2 UTSW 4 128475789 missense
R8974:Csmd2 UTSW 4 128552587 missense
R9001:Csmd2 UTSW 4 128414286 missense
R9132:Csmd2 UTSW 4 128549214 missense
R9245:Csmd2 UTSW 4 128306375 missense
R9249:Csmd2 UTSW 4 128419530 nonsense probably null
R9254:Csmd2 UTSW 4 128197319 missense
R9265:Csmd2 UTSW 4 128400370 missense
R9407:Csmd2 UTSW 4 128548820 missense
R9432:Csmd2 UTSW 4 128277211 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- CGACTGGGATGTCACCTCATTC -3'
(R):5'- ATACTGTATCGCTGCTTCTTGG -3'

Sequencing Primer
(F):5'- GGGATGTCACCTCATTCTCTTCAG -3'
(R):5'- GCTTCTTGGTTAAGCCCACTGG -3'
Posted On 2019-06-26