Mutagenetix > Incidental Mutations

Incidental Mutation 'R7234:Gsap'

562690

Institutional Source

Beutler Lab

Gene Symbol

Gsap

Ensembl Gene

ENSMUSG00000039934

Gene Name

gamma-secretase activating protein

Synonyms

A530088I07Rik, Pion

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R7234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21186255-21315132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21186435 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 25 (T25A)

Ref Sequence

ENSEMBL: ENSMUSP00000043679 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036031] [ENSMUST00000195969] [ENSMUST00000198014] [ENSMUST00000198071] [ENSMUST00000198937]

Predicted Effect

probably benign
Transcript: ENSMUST00000036031
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043679
Gene: ENSMUSG00000039934
AA Change: T25A

Domain	Start	End	E-Value	Type
low complexity region	386	398	N/A	INTRINSIC
Pfam:GSAP-16	646	753	6.8e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195969
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000198014
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000198071
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000198937
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142986
Gene: ENSMUSG00000039934
AA Change: T25A

Domain	Start	End	E-Value	Type
low complexity region	355	367	N/A	INTRINSIC
Pfam:GSAP-16	608	722	1.6e-42	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accumulation of neurotoxic amyloid-beta is a major hallmark of Alzheimer disease (AD; MIM 104300). Formation of amyloid-beta is catalyzed by gamma-secretase (see PSEN1; MIM 104311), a protease with numerous substrates. PION, or GSAP, selectively increases amyloid-beta production through a mechanism involving its interaction with both gamma-secretase and its substrate, the amyloid-beta precursor protein (APP; MIM 104760) C-terminal fragment (APP-CTF) (He et al., 2010 [PubMed 20811458]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Acy3	T	A	19: 3,987,758	Y88*	probably null	Het
AI606181	T	A	19: 41,593,637	I82N	unknown	Het
Akap1	T	C	11: 88,838,982	Y638C	probably damaging	Het
Angpt1	T	C	15: 42,459,725	N383D	probably benign	Het
Ank	T	C	15: 27,571,656		probably null	Het
Aoc1	C	T	6: 48,905,816	Q209*	probably null	Het
Apol7c	A	T	15: 77,525,675	L357*	probably null	Het
Atxn2l	A	G	7: 126,493,201	L958P	probably damaging	Het
Cab39l	T	A	14: 59,496,946		probably null	Het
Cdk5rap2	A	G	4: 70,376,787		probably null	Het
Cdkn3	T	C	14: 46,771,461	S204P	unknown	Het
Cds2	T	C	2: 132,304,480		probably null	Het
Cideb	C	T	14: 55,754,560	R179H	probably benign	Het
Cped1	A	G	6: 22,254,626	Q1006R	probably damaging	Het
Csmd2	A	G	4: 128,456,779	Y1547C		Het
Dicer1	A	G	12: 104,708,849	L718S	probably damaging	Het
Dyrk2	T	C	10: 118,860,231	H374R	possibly damaging	Het
Edem2	A	T	2: 155,710,966	Y283N	probably benign	Het
Ero1lb	A	T	13: 12,600,314	S345C	possibly damaging	Het
Fam83g	T	C	11: 61,702,516	V292A	possibly damaging	Het
Farp2	A	G	1: 93,580,119	D513G	possibly damaging	Het
Fbxl5	A	G	5: 43,758,220	W617R	probably benign	Het
Fzd7	G	A	1: 59,483,284	V109M	probably damaging	Het
Gbp5	A	T	3: 142,521,137	H583L	probably benign	Het
Gm10306	T	A	4: 94,556,795	L84M	unknown	Het
Gm11756	G	T	4: 73,917,571	L219M	probably benign	Het
Hectd4	G	T	5: 121,329,073	R2466L	possibly damaging	Het
Ide	C	A	19: 37,290,785	C557F		Het
Igdcc4	T	A	9: 65,135,468	C1234*	probably null	Het
Ints4	A	G	7: 97,530,300	I701V	probably benign	Het
Kalrn	T	A	16: 34,176,422	I1467F	possibly damaging	Het
Kcnip3	C	A	2: 127,521,336	R2M	unknown	Het
Kcnrg	A	T	14: 61,608,082	E190D	unknown	Het
Klk13	T	C	7: 43,721,417	L131P	probably damaging	Het
Lhcgr	A	T	17: 88,791,931	L14Q	possibly damaging	Het
Mdm4	A	T	1: 133,011,115	D80E	probably damaging	Het
Mib2	G	T	4: 155,657,893	Q311K	probably damaging	Het
Mycbp2	A	T	14: 103,215,337	S1703T	probably damaging	Het
Naip6	A	T	13: 100,315,503	C200*	probably null	Het
Ncapd3	T	A	9: 27,050,359	I361N	probably damaging	Het
Nom1	A	G	5: 29,435,453	E259G	probably benign	Het
Olfr16	T	A	1: 172,957,106	F104I	probably damaging	Het
Olfr620	A	G	7: 103,611,882	L157P	probably damaging	Het
Plxna2	A	T	1: 194,806,390	H1658L	probably damaging	Het
Ranbp6	T	C	19: 29,812,062	T297A	possibly damaging	Het
Rap1gap	T	A	4: 137,728,540	C722*	probably null	Het
Ribc2	A	G	15: 85,135,532	K172E	probably benign	Het
Scamp5	C	A	9: 57,447,140	W77L	probably damaging	Het
Scin	T	A	12: 40,080,958	K319*	probably null	Het
Sec16a	G	T	2: 26,439,768	T745K	probably damaging	Het
Slc15a2	G	A	16: 36,757,811	A403V	probably benign	Het
Slco6c1	A	G	1: 97,125,741	V145A	probably benign	Het
Sncaip	C	T	18: 52,915,344	H951Y	probably benign	Het
Spem1	A	G	11: 69,821,804		probably null	Het
Spen	C	T	4: 141,479,135	R727Q	unknown	Het
Thra	T	C	11: 98,763,718	S305P	probably damaging	Het
Tlr1	A	G	5: 64,926,724	V170A	probably damaging	Het
Tmem260	T	A	14: 48,505,329	C388*	probably null	Het
Tmem60	T	A	5: 20,886,621	V128D	possibly damaging	Het
Tpo	G	A	12: 30,092,686	P680S	probably benign	Het
Ttc30a2	A	T	2: 75,976,196	Y657*	probably null	Het
Umodl1	A	G	17: 30,986,621	E730G	possibly damaging	Het
Vmn2r69	T	C	7: 85,407,107	T608A	probably benign	Het
Xrra1	G	A	7: 99,914,249	S481N	possibly damaging	Het
Zc3h4	G	A	7: 16,429,036	V446I	unknown	Het

Other mutations in Gsap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Gsap	APN	5	21221305	splice site	probably benign
IGL00788:Gsap	APN	5	21254024	missense	probably damaging	0.96
IGL01344:Gsap	APN	5	21242883	critical splice donor site	probably null
IGL01347:Gsap	APN	5	21226320	missense	probably benign	0.08
IGL01618:Gsap	APN	5	21226248	missense	probably damaging	1.00
IGL01730:Gsap	APN	5	21290154	unclassified	probably benign
IGL02061:Gsap	APN	5	21281611	splice site	probably benign
IGL02161:Gsap	APN	5	21253379	missense	probably damaging	1.00
IGL02259:Gsap	APN	5	21186400	missense	probably benign	0.01
IGL02635:Gsap	APN	5	21289816	missense	probably damaging	1.00
IGL02684:Gsap	APN	5	21242803	critical splice acceptor site	probably null
IGL02822:Gsap	APN	5	21217444	missense	probably damaging	1.00
IGL03231:Gsap	APN	5	21229166	missense	probably damaging	0.99
PIT4305001:Gsap	UTSW	5	21186409	missense	probably damaging	0.98
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0012:Gsap	UTSW	5	21226229	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0019:Gsap	UTSW	5	21270622	splice site	probably benign
R0045:Gsap	UTSW	5	21226832	missense	possibly damaging	0.77
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0054:Gsap	UTSW	5	21250935	splice site	probably benign
R0409:Gsap	UTSW	5	21222445	splice site	probably benign
R0507:Gsap	UTSW	5	21269963	missense	possibly damaging	0.75
R0624:Gsap	UTSW	5	21253951	splice site	probably null
R1037:Gsap	UTSW	5	21251165	splice site	probably benign
R1076:Gsap	UTSW	5	21287694	missense	possibly damaging	0.75
R1459:Gsap	UTSW	5	21207238	splice site	probably benign
R1757:Gsap	UTSW	5	21281037	missense	probably damaging	0.98
R1852:Gsap	UTSW	5	21290545	splice site	probably null
R2034:Gsap	UTSW	5	21270595	missense	probably damaging	1.00
R2069:Gsap	UTSW	5	21226839	splice site	probably benign
R2125:Gsap	UTSW	5	21242813	missense	probably damaging	1.00
R2172:Gsap	UTSW	5	21222440	critical splice donor site	probably null
R2310:Gsap	UTSW	5	21196090	nonsense	probably null
R2337:Gsap	UTSW	5	21288630	missense	probably damaging	1.00
R3442:Gsap	UTSW	5	21278127	missense	probably damaging	1.00
R4229:Gsap	UTSW	5	21246977	missense	probably benign	0.00
R4271:Gsap	UTSW	5	21226350	critical splice donor site	probably null
R4551:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4553:Gsap	UTSW	5	21290571	missense	probably damaging	1.00
R4649:Gsap	UTSW	5	21226311	missense	probably damaging	1.00
R4687:Gsap	UTSW	5	21246971	utr 3 prime	probably benign
R4799:Gsap	UTSW	5	21250943	missense	probably benign	0.05
R4857:Gsap	UTSW	5	21287799	splice site	probably null
R4973:Gsap	UTSW	5	21254039	missense	probably benign	0.04
R5015:Gsap	UTSW	5	21222408	missense	probably damaging	1.00
R5031:Gsap	UTSW	5	21242826	missense	possibly damaging	0.57
R5120:Gsap	UTSW	5	21269936	missense	probably damaging	0.96
R5451:Gsap	UTSW	5	21217447	missense	probably damaging	1.00
R5469:Gsap	UTSW	5	21290544	missense	possibly damaging	0.92
R5519:Gsap	UTSW	5	21289859	missense	probably damaging	1.00
R5588:Gsap	UTSW	5	21251149	missense	probably damaging	1.00
R5650:Gsap	UTSW	5	21251053	missense	probably damaging	0.99
R6064:Gsap	UTSW	5	21229225	missense	possibly damaging	0.56
R6139:Gsap	UTSW	5	21281540	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21226325	missense	probably damaging	1.00
R6148:Gsap	UTSW	5	21270577	missense	probably benign	0.39
R6226:Gsap	UTSW	5	21217431	missense	probably damaging	1.00
R6859:Gsap	UTSW	5	21281018	missense	probably damaging	0.99
R6977:Gsap	UTSW	5	21271221	missense	probably damaging	1.00
R6995:Gsap	UTSW	5	21271237	missense	possibly damaging	0.58
R7013:Gsap	UTSW	5	21278110	missense	probably benign	0.39
R7159:Gsap	UTSW	5	21270620	splice site	probably null
R7181:Gsap	UTSW	5	21253429	missense	probably damaging	1.00
R7332:Gsap	UTSW	5	21290121	missense	probably benign	0.00
R7381:Gsap	UTSW	5	21226787	missense	probably damaging	0.96
R8047:Gsap	UTSW	5	21257868	critical splice acceptor site	probably null
R8062:Gsap	UTSW	5	21194463	missense	probably damaging	1.00
R8126:Gsap	UTSW	5	21270012	missense	probably benign	0.04
R8219:Gsap	UTSW	5	21251115	missense	probably benign	0.00
R8355:Gsap	UTSW	5	21251019	nonsense	probably null
R8472:Gsap	UTSW	5	21222434	nonsense	probably null
Z1177:Gsap	UTSW	5	21251032	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGGACTAAAGAAAACCTGCCC -3'
(R):5'- TTGTCCTGATCCTAGCTGAGC -3'

Sequencing Primer
(F):5'- TCCAGTCTGGAAGCTGCTG -3'
(R):5'- ATCCTAGCTGAGCCCAGGAG -3'

Posted On

2019-06-26