Incidental Mutation 'R7234:Zc3h4'
ID562697
Institutional Source Beutler Lab
Gene Symbol Zc3h4
Ensembl Gene ENSMUSG00000059273
Gene Namezinc finger CCCH-type containing 4
SynonymsLOC330474, Kiaa1064-hp, Bwq1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16400910-16437696 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16429036 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 446 (V446I)
Ref Sequence ENSEMBL: ENSMUSP00000096386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098789] [ENSMUST00000209289]
Predicted Effect unknown
Transcript: ENSMUST00000098789
AA Change: V446I
SMART Domains Protein: ENSMUSP00000096386
Gene: ENSMUSG00000059273
AA Change: V446I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 35 97 N/A INTRINSIC
low complexity region 144 170 N/A INTRINSIC
low complexity region 184 247 N/A INTRINSIC
low complexity region 264 324 N/A INTRINSIC
ZnF_C3H1 341 366 1.95e-3 SMART
ZnF_C3H1 370 395 6.17e-6 SMART
ZnF_C3H1 396 419 3.38e-1 SMART
low complexity region 433 451 N/A INTRINSIC
low complexity region 456 486 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 552 641 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
coiled coil region 729 760 N/A INTRINSIC
internal_repeat_2 767 822 3.38e-5 PROSPERO
low complexity region 837 850 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
internal_repeat_2 986 1037 3.38e-5 PROSPERO
low complexity region 1049 1072 N/A INTRINSIC
low complexity region 1077 1097 N/A INTRINSIC
low complexity region 1175 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209289
AA Change: V454I
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of CCCH (C-x8-C-x5-C-x3-H type) zinc finger domain-containing proteins. These zinc finger domains, which coordinate zinc finger binding and are characterized by three cysteine residues and one histidine residue, are nucleic acid-binding. Other family members are known to function in post-transcriptional regulation. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Other mutations in Zc3h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zc3h4 APN 7 16422234 missense unknown
IGL00923:Zc3h4 APN 7 16429692 missense unknown
IGL01541:Zc3h4 APN 7 16434332 missense unknown
IGL02115:Zc3h4 APN 7 16425783 missense unknown
IGL02303:Zc3h4 APN 7 16434077 missense unknown
IGL02336:Zc3h4 APN 7 16425777 missense unknown
IGL02734:Zc3h4 APN 7 16423924 missense unknown
IGL02736:Zc3h4 APN 7 16417383 nonsense probably null
BB008:Zc3h4 UTSW 7 16432984 missense unknown
BB018:Zc3h4 UTSW 7 16432984 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0220:Zc3h4 UTSW 7 16429273 missense unknown
R0336:Zc3h4 UTSW 7 16435178 missense unknown
R0416:Zc3h4 UTSW 7 16420275 missense probably damaging 1.00
R0666:Zc3h4 UTSW 7 16434772 missense unknown
R0864:Zc3h4 UTSW 7 16420179 missense probably damaging 0.99
R1068:Zc3h4 UTSW 7 16429236 missense unknown
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1472:Zc3h4 UTSW 7 16434770 missense unknown
R1665:Zc3h4 UTSW 7 16429580 missense unknown
R2087:Zc3h4 UTSW 7 16416940 missense possibly damaging 0.72
R2182:Zc3h4 UTSW 7 16422516 missense unknown
R2508:Zc3h4 UTSW 7 16434339 missense unknown
R3037:Zc3h4 UTSW 7 16421485 missense unknown
R4439:Zc3h4 UTSW 7 16429111 missense unknown
R4576:Zc3h4 UTSW 7 16434654 missense unknown
R5030:Zc3h4 UTSW 7 16422230 missense unknown
R5160:Zc3h4 UTSW 7 16434648 missense unknown
R5270:Zc3h4 UTSW 7 16434515 missense unknown
R5490:Zc3h4 UTSW 7 16429005 missense unknown
R5519:Zc3h4 UTSW 7 16435232 missense unknown
R5770:Zc3h4 UTSW 7 16429611 missense unknown
R7067:Zc3h4 UTSW 7 16429051 nonsense probably null
R7316:Zc3h4 UTSW 7 16435335 missense unknown
R7771:Zc3h4 UTSW 7 16429899 missense unknown
R7852:Zc3h4 UTSW 7 16422467 missense unknown
R7931:Zc3h4 UTSW 7 16432984 missense unknown
RF001:Zc3h4 UTSW 7 16429687 small insertion probably benign
RF039:Zc3h4 UTSW 7 16429618 small deletion probably benign
X0064:Zc3h4 UTSW 7 16422516 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTACAATTGTGTACACTGTGCCC -3'
(R):5'- ACAGTGGCTCATGTGTTGGC -3'

Sequencing Primer
(F):5'- CTGTGCCCAGGGTGATGAAG -3'
(R):5'- CTCATGTGTTGGCAGGGACATC -3'
Posted On2019-06-26