Incidental Mutation 'R7234:Xrra1'
ID562701
Institutional Source Beutler Lab
Gene Symbol Xrra1
Ensembl Gene ENSMUSG00000035211
Gene NameX-ray radiation resistance associated 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location99859116-99917822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99914249 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 481 (S481N)
Ref Sequence ENSEMBL: ENSMUSP00000035929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036155
AA Change: S481N

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035929
Gene: ENSMUSG00000035211
AA Change: S481N

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Blast:LRR 144 168 4e-6 BLAST
LRR 191 214 2.02e-1 SMART
LRR 232 253 1.67e2 SMART
LRR 257 278 6.41e1 SMART
LRR 371 398 4.09e1 SMART
low complexity region 748 756 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Xrra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Xrra1 APN 7 99875194 missense possibly damaging 0.76
IGL01938:Xrra1 APN 7 99879469 critical splice donor site probably null
IGL02064:Xrra1 APN 7 99914204 missense probably damaging 1.00
IGL02286:Xrra1 APN 7 99914227 missense possibly damaging 0.62
IGL02415:Xrra1 APN 7 99915943 missense probably benign
R0332:Xrra1 UTSW 7 99876242 missense probably damaging 1.00
R0465:Xrra1 UTSW 7 99879371 missense probably benign 0.00
R0533:Xrra1 UTSW 7 99875145 splice site probably null
R0601:Xrra1 UTSW 7 99910968 missense possibly damaging 0.95
R1539:Xrra1 UTSW 7 99871357 missense probably damaging 1.00
R1672:Xrra1 UTSW 7 99898440 missense probably benign 0.00
R1687:Xrra1 UTSW 7 99876244 missense probably damaging 1.00
R1962:Xrra1 UTSW 7 99911020 missense probably damaging 1.00
R2504:Xrra1 UTSW 7 99897596 missense probably damaging 1.00
R4765:Xrra1 UTSW 7 99906568 missense probably benign 0.19
R4967:Xrra1 UTSW 7 99906523 missense probably damaging 0.99
R5213:Xrra1 UTSW 7 99898483 missense possibly damaging 0.47
R5663:Xrra1 UTSW 7 99886043 missense probably damaging 1.00
R5986:Xrra1 UTSW 7 99876255 missense probably benign 0.40
R6256:Xrra1 UTSW 7 99914464 missense probably damaging 0.99
R6269:Xrra1 UTSW 7 99917472 missense probably damaging 1.00
R7316:Xrra1 UTSW 7 99876216 critical splice acceptor site probably null
R7655:Xrra1 UTSW 7 99910982 missense probably benign 0.10
R7656:Xrra1 UTSW 7 99910982 missense probably benign 0.10
R8688:Xrra1 UTSW 7 99906545 missense probably damaging 1.00
R8788:Xrra1 UTSW 7 99906554 missense probably benign 0.02
X0017:Xrra1 UTSW 7 99916100 missense probably damaging 1.00
X0021:Xrra1 UTSW 7 99898486 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGTGTGATTGCTCTCTGCC -3'
(R):5'- ACTCTTGGCGTCATCATCTG -3'

Sequencing Primer
(F):5'- CTGCCTCCCCAAACTGC -3'
(R):5'- ATGGGTGCTCTGAGCTCAC -3'
Posted On2019-06-26