Incidental Mutation 'R0577:Fbxw17'
ID56271
Institutional Source Beutler Lab
Gene Symbol Fbxw17
Ensembl Gene ENSMUSG00000037816
Gene NameF-box and WD-40 domain protein 17
Synonyms
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0577 (G1)
Quality Score110
Status Validated
Chromosome13
Chromosomal Location50417864-50433780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50431583 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 274 (L274P)
Ref Sequence ENSEMBL: ENSMUSP00000041750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046974] [ENSMUST00000176479] [ENSMUST00000176543] [ENSMUST00000176772]
Predicted Effect probably benign
Transcript: ENSMUST00000046974
AA Change: L274P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041750
Gene: ENSMUSG00000037816
AA Change: L274P

DomainStartEndE-ValueType
Pfam:F-box 3 47 1.4e-6 PFAM
Pfam:F-box-like 4 48 6.7e-12 PFAM
WD40 85 133 9.94e-1 SMART
Blast:WD40 136 175 6e-12 BLAST
WD40 369 408 1.07e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176470
Predicted Effect probably benign
Transcript: ENSMUST00000176479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176508
Predicted Effect probably benign
Transcript: ENSMUST00000176543
Predicted Effect probably benign
Transcript: ENSMUST00000176772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185962
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Fbxw17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Fbxw17 APN 13 50423300 missense possibly damaging 0.49
IGL02477:Fbxw17 APN 13 50423817 missense possibly damaging 0.68
R0364:Fbxw17 UTSW 13 50432441 missense possibly damaging 0.83
R1709:Fbxw17 UTSW 13 50431657 missense probably benign 0.00
R1791:Fbxw17 UTSW 13 50425774 unclassified probably benign
R4811:Fbxw17 UTSW 13 50425633 missense probably benign 0.01
R5013:Fbxw17 UTSW 13 50432470 missense probably benign
R5153:Fbxw17 UTSW 13 50419861 missense probably damaging 1.00
R5233:Fbxw17 UTSW 13 50432354 intron probably benign
R5475:Fbxw17 UTSW 13 50425648 missense probably benign
R6146:Fbxw17 UTSW 13 50432512 missense probably benign 0.38
R6294:Fbxw17 UTSW 13 50423803 missense probably benign
R6644:Fbxw17 UTSW 13 50423219 missense probably damaging 1.00
R6798:Fbxw17 UTSW 13 50433264 intron probably null
R7007:Fbxw17 UTSW 13 50423772 missense probably damaging 1.00
R7059:Fbxw17 UTSW 13 50432548 missense probably damaging 1.00
R7565:Fbxw17 UTSW 13 50433362 missense probably damaging 1.00
R7685:Fbxw17 UTSW 13 50425644 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATTGCATTATGTGGGCAGCCAG -3'
(R):5'- CCGGTACATGAAACATGCAGCAAAG -3'

Sequencing Primer
(F):5'- GCTGTCCAGGCAGTCCTAC -3'
(R):5'- ACAGCAGTGTCCTGAAGTTC -3'
Posted On2013-07-11