Incidental Mutation 'R0577:Olfr725'
ID56272
Institutional Source Beutler Lab
Gene Symbol Olfr725
Ensembl Gene ENSMUSG00000068437
Gene Nameolfactory receptor 725
SynonymsMOR246-3, GA_x6K02T2PMLR-5725741-5724776, MOR246-7_p
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R0577 (G1)
Quality Score145
Status Not validated
Chromosome14
Chromosomal Location50034314-50040375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50034792 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 204 (G204R)
Ref Sequence ENSEMBL: ENSMUSP00000145828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089844] [ENSMUST00000206920]
Predicted Effect probably damaging
Transcript: ENSMUST00000089844
AA Change: G204R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087282
Gene: ENSMUSG00000068437
AA Change: G204R

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 36 282 1.8e-7 PFAM
Pfam:7tm_1 41 287 5.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206920
AA Change: G204R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Olfr725
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Olfr725 APN 14 50035050 missense probably benign 0.29
IGL01412:Olfr725 APN 14 50035313 missense probably benign
IGL03241:Olfr725 APN 14 50035068 missense possibly damaging 0.70
IGL03268:Olfr725 APN 14 50034567 missense probably damaging 0.98
IGL03348:Olfr725 APN 14 50034755 missense probably benign 0.00
R0358:Olfr725 UTSW 14 50035286 missense probably damaging 0.97
R2094:Olfr725 UTSW 14 50034714 missense probably damaging 1.00
R2424:Olfr725 UTSW 14 50034824 missense probably damaging 1.00
R3421:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R3422:Olfr725 UTSW 14 50034540 missense possibly damaging 0.66
R4436:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4437:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4438:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4684:Olfr725 UTSW 14 50034830 missense probably damaging 1.00
R4717:Olfr725 UTSW 14 50035364 missense probably damaging 0.98
R5253:Olfr725 UTSW 14 50035288 missense possibly damaging 0.91
R5254:Olfr725 UTSW 14 50034678 missense possibly damaging 0.60
R5641:Olfr725 UTSW 14 50035289 missense probably benign 0.04
R5881:Olfr725 UTSW 14 50034987 missense probably benign 0.00
R5906:Olfr725 UTSW 14 50034849 missense probably benign 0.05
R6511:Olfr725 UTSW 14 50034809 missense probably damaging 1.00
R7837:Olfr725 UTSW 14 50034576 missense probably damaging 1.00
R7920:Olfr725 UTSW 14 50034576 missense probably damaging 1.00
X0062:Olfr725 UTSW 14 50034860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCTCAGCTTTGACATAGCTGC -3'
(R):5'- TGCTACCCCTAAAATGCTTGCTGAC -3'

Sequencing Primer
(F):5'- CAGCAAGGACTTTGTCAACTG -3'
(R):5'- TGACAATCATGAGTCGCCG -3'
Posted On2013-07-11