Mutagenetix > Incidental Mutation

Incidental Mutation 'R7234:Umodl1'

562729

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30986621 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 730 (E730G)

Ref Sequence

ENSEMBL: ENSMUSP00000067443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066554
AA Change: E730G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: E730G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066981
AA Change: E701G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: E701G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114555
AA Change: E730G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: E730G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Acy3	T	A	19: 3,987,758	Y88*	probably null	Het
AI606181	T	A	19: 41,593,637	I82N	unknown	Het
Akap1	T	C	11: 88,838,982	Y638C	probably damaging	Het
Angpt1	T	C	15: 42,459,725	N383D	probably benign	Het
Ank	T	C	15: 27,571,656		probably null	Het
Aoc1	C	T	6: 48,905,816	Q209*	probably null	Het
Apol7c	A	T	15: 77,525,675	L357*	probably null	Het
Atxn2l	A	G	7: 126,493,201	L958P	probably damaging	Het
Cab39l	T	A	14: 59,496,946		probably null	Het
Cdk5rap2	A	G	4: 70,376,787		probably null	Het
Cdkn3	T	C	14: 46,771,461	S204P	unknown	Het
Cds2	T	C	2: 132,304,480		probably null	Het
Cideb	C	T	14: 55,754,560	R179H	probably benign	Het
Cped1	A	G	6: 22,254,626	Q1006R	probably damaging	Het
Csmd2	A	G	4: 128,456,779	Y1547C		Het
Dicer1	A	G	12: 104,708,849	L718S	probably damaging	Het
Dyrk2	T	C	10: 118,860,231	H374R	possibly damaging	Het
Edem2	A	T	2: 155,710,966	Y283N	probably benign	Het
Ero1lb	A	T	13: 12,600,314	S345C	possibly damaging	Het
Fam83g	T	C	11: 61,702,516	V292A	possibly damaging	Het
Farp2	A	G	1: 93,580,119	D513G	possibly damaging	Het
Fbxl5	A	G	5: 43,758,220	W617R	probably benign	Het
Fzd7	G	A	1: 59,483,284	V109M	probably damaging	Het
Gbp5	A	T	3: 142,521,137	H583L	probably benign	Het
Gm10306	T	A	4: 94,556,795	L84M	unknown	Het
Gm11756	G	T	4: 73,917,571	L219M	probably benign	Het
Gsap	A	G	5: 21,186,435	T25A	probably benign	Het
Hectd4	G	T	5: 121,329,073	R2466L	possibly damaging	Het
Ide	C	A	19: 37,290,785	C557F		Het
Igdcc4	T	A	9: 65,135,468	C1234*	probably null	Het
Ints4	A	G	7: 97,530,300	I701V	probably benign	Het
Kalrn	T	A	16: 34,176,422	I1467F	possibly damaging	Het
Kcnip3	C	A	2: 127,521,336	R2M	unknown	Het
Kcnrg	A	T	14: 61,608,082	E190D	unknown	Het
Klk13	T	C	7: 43,721,417	L131P	probably damaging	Het
Lhcgr	A	T	17: 88,791,931	L14Q	possibly damaging	Het
Mdm4	A	T	1: 133,011,115	D80E	probably damaging	Het
Mib2	G	T	4: 155,657,893	Q311K	probably damaging	Het
Mycbp2	A	T	14: 103,215,337	S1703T	probably damaging	Het
Naip6	A	T	13: 100,315,503	C200*	probably null	Het
Ncapd3	T	A	9: 27,050,359	I361N	probably damaging	Het
Nom1	A	G	5: 29,435,453	E259G	probably benign	Het
Olfr16	T	A	1: 172,957,106	F104I	probably damaging	Het
Olfr620	A	G	7: 103,611,882	L157P	probably damaging	Het
Plxna2	A	T	1: 194,806,390	H1658L	probably damaging	Het
Ranbp6	T	C	19: 29,812,062	T297A	possibly damaging	Het
Rap1gap	T	A	4: 137,728,540	C722*	probably null	Het
Ribc2	A	G	15: 85,135,532	K172E	probably benign	Het
Scamp5	C	A	9: 57,447,140	W77L	probably damaging	Het
Scin	T	A	12: 40,080,958	K319*	probably null	Het
Sec16a	G	T	2: 26,439,768	T745K	probably damaging	Het
Slc15a2	G	A	16: 36,757,811	A403V	probably benign	Het
Slco6c1	A	G	1: 97,125,741	V145A	probably benign	Het
Sncaip	C	T	18: 52,915,344	H951Y	probably benign	Het
Spem1	A	G	11: 69,821,804		probably null	Het
Spen	C	T	4: 141,479,135	R727Q	unknown	Het
Thra	T	C	11: 98,763,718	S305P	probably damaging	Het
Tlr1	A	G	5: 64,926,724	V170A	probably damaging	Het
Tmem260	T	A	14: 48,505,329	C388*	probably null	Het
Tmem60	T	A	5: 20,886,621	V128D	possibly damaging	Het
Tpo	G	A	12: 30,092,686	P680S	probably benign	Het
Ttc30a2	A	T	2: 75,976,196	Y657*	probably null	Het
Vmn2r69	T	C	7: 85,407,107	T608A	probably benign	Het
Xrra1	G	A	7: 99,914,249	S481N	possibly damaging	Het
Zc3h4	G	A	7: 16,429,036	V446I	unknown	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACAAGCTCTGTTCCCTGG -3'
(R):5'- TACTAGACCAGACACCTGCTG -3'

Sequencing Primer
(F):5'- TCGAGAGTCACAGGAACTTATC -3'
(R):5'- GACACCTGCTGCCAAAGAG -3'

Posted On

2019-06-26