Incidental Mutation 'R7234:Umodl1'
ID562729
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30986621 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 730 (E730G)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066554
AA Change: E730G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: E730G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: E701G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: E701G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114555
AA Change: E730G

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: E730G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGACAAGCTCTGTTCCCTGG -3'
(R):5'- TACTAGACCAGACACCTGCTG -3'

Sequencing Primer
(F):5'- TCGAGAGTCACAGGAACTTATC -3'
(R):5'- GACACCTGCTGCCAAAGAG -3'
Posted On2019-06-26