Incidental Mutation 'R7234:Lhcgr'
ID562730
Institutional Source Beutler Lab
Gene Symbol Lhcgr
Ensembl Gene ENSMUSG00000024107
Gene Nameluteinizing hormone/choriogonadotropin receptor
SynonymsLhr, LH-R, Gpcr19-rs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7234 (G1)
Quality Score180.009
Status Validated
Chromosome17
Chromosomal Location88741549-88791976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88791931 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 14 (L14Q)
Ref Sequence ENSEMBL: ENSMUSP00000024916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024916
AA Change: L14Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: L14Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 33 66 4.4e0 SMART
Pfam:LRR_5 155 273 2.9e-5 PFAM
Pfam:7tm_1 380 627 1.2e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Sncaip C T 18: 52,915,344 H951Y probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Lhcgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lhcgr APN 17 88742446 missense probably benign
IGL00661:Lhcgr APN 17 88750118 missense probably benign
IGL00840:Lhcgr APN 17 88753736 splice site probably benign
IGL01434:Lhcgr APN 17 88742437 missense probably damaging 1.00
IGL01489:Lhcgr APN 17 88764973 splice site probably benign
IGL02077:Lhcgr APN 17 88750130 missense probably benign 0.06
IGL02533:Lhcgr APN 17 88742410 missense probably benign 0.00
IGL02948:Lhcgr APN 17 88742622 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0556:Lhcgr UTSW 17 88772063 missense probably damaging 0.99
R1824:Lhcgr UTSW 17 88750157 missense probably benign 0.00
R1846:Lhcgr UTSW 17 88765147 critical splice donor site probably null
R1852:Lhcgr UTSW 17 88765176 missense probably damaging 0.99
R2352:Lhcgr UTSW 17 88742299 missense possibly damaging 0.52
R3147:Lhcgr UTSW 17 88758343 missense probably damaging 0.96
R3756:Lhcgr UTSW 17 88753856 missense possibly damaging 0.77
R4180:Lhcgr UTSW 17 88742283 missense probably damaging 1.00
R4540:Lhcgr UTSW 17 88755608 missense probably benign
R4688:Lhcgr UTSW 17 88765152 missense probably damaging 0.99
R4717:Lhcgr UTSW 17 88742467 missense probably benign 0.00
R4723:Lhcgr UTSW 17 88742602 missense probably benign 0.09
R4776:Lhcgr UTSW 17 88742697 missense probably damaging 1.00
R4903:Lhcgr UTSW 17 88742361 missense probably damaging 1.00
R5195:Lhcgr UTSW 17 88742946 missense probably damaging 1.00
R5231:Lhcgr UTSW 17 88755611 missense probably damaging 1.00
R5361:Lhcgr UTSW 17 88742853 missense probably damaging 1.00
R5683:Lhcgr UTSW 17 88772019 missense probably benign 0.00
R5758:Lhcgr UTSW 17 88742548 missense probably damaging 0.99
R5929:Lhcgr UTSW 17 88743008 nonsense probably null
R5987:Lhcgr UTSW 17 88755578 missense probably damaging 1.00
R6268:Lhcgr UTSW 17 88742704 missense probably damaging 1.00
R6477:Lhcgr UTSW 17 88742373 missense probably damaging 1.00
R6610:Lhcgr UTSW 17 88769879 missense possibly damaging 0.93
R7282:Lhcgr UTSW 17 88758383 missense probably benign
R7320:Lhcgr UTSW 17 88742078 missense probably benign
R7398:Lhcgr UTSW 17 88772046 missense probably benign 0.03
R7710:Lhcgr UTSW 17 88742782 missense probably damaging 1.00
R8034:Lhcgr UTSW 17 88742356 missense probably damaging 1.00
R8108:Lhcgr UTSW 17 88742050 nonsense probably null
R8150:Lhcgr UTSW 17 88742249 nonsense probably null
R8151:Lhcgr UTSW 17 88742249 nonsense probably null
R8236:Lhcgr UTSW 17 88742586 nonsense probably null
U24488:Lhcgr UTSW 17 88772085 critical splice acceptor site probably null
X0028:Lhcgr UTSW 17 88742722 missense probably damaging 1.00
Z1176:Lhcgr UTSW 17 88742270 missense probably damaging 1.00
Z1177:Lhcgr UTSW 17 88753905 missense probably benign 0.00
Z1177:Lhcgr UTSW 17 88764981 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAAGTTGACCAGGGTCCAG -3'
(R):5'- AGTCCCAGGTCAAGGAGAAC -3'

Sequencing Primer
(F):5'- TTGACCAGGGTCCAGCCTTAC -3'
(R):5'- CCAGGTCAAGGAGAACAGGGAC -3'
Posted On2019-06-26