Incidental Mutation 'R7234:Sncaip'
ID562731
Institutional Source Beutler Lab
Gene Symbol Sncaip
Ensembl Gene ENSMUSG00000024534
Gene Namesynuclein, alpha interacting protein (synphilin)
Synonymssynphilin-1, 4933427B05Rik, SYPH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R7234 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location52767709-52915935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52915344 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 951 (H951Y)
Ref Sequence ENSEMBL: ENSMUSP00000025413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025413] [ENSMUST00000115410] [ENSMUST00000163742] [ENSMUST00000177861] [ENSMUST00000178011] [ENSMUST00000178678] [ENSMUST00000178883] [ENSMUST00000179625] [ENSMUST00000179689] [ENSMUST00000180259]
Predicted Effect probably benign
Transcript: ENSMUST00000025413
AA Change: H951Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025413
Gene: ENSMUSG00000024534
AA Change: H951Y

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115410
SMART Domains Protein: ENSMUSP00000111069
Gene: ENSMUSG00000024534

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163742
SMART Domains Protein: ENSMUSP00000127189
Gene: ENSMUSG00000024534

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177861
Predicted Effect probably benign
Transcript: ENSMUST00000178011
SMART Domains Protein: ENSMUSP00000137549
Gene: ENSMUSG00000024534

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
PDB:2KES|A 511 549 1e-9 PDB
low complexity region 550 571 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178678
AA Change: H951Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137367
Gene: ENSMUSG00000024534
AA Change: H951Y

DomainStartEndE-ValueType
ANK 348 378 2.07e-2 SMART
ANK 383 412 1.04e2 SMART
ANK 418 447 5.03e2 SMART
ANK 455 484 4.26e-4 SMART
Pfam:SNCAIP_SNCA_bd 511 556 7.9e-30 PFAM
low complexity region 656 669 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 745 755 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 869 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178883
Predicted Effect probably benign
Transcript: ENSMUST00000179625
SMART Domains Protein: ENSMUSP00000136838
Gene: ENSMUSG00000024534

DomainStartEndE-ValueType
ANK 358 387 5.03e2 SMART
ANK 395 424 4.26e-4 SMART
PDB:2KES|A 451 489 9e-10 PDB
low complexity region 490 511 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 613 626 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 809 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179689
SMART Domains Protein: ENSMUSP00000137107
Gene: ENSMUSG00000024534

DomainStartEndE-ValueType
ANK 43 72 4.26e-4 SMART
PDB:2KES|A 99 137 6e-10 PDB
low complexity region 138 159 N/A INTRINSIC
low complexity region 244 257 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 333 343 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 457 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180259
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several protein-protein interaction domains, including ankyrin-like repeats, a coiled-coil domain, and an ATP/GTP-binding motif. The encoded protein interacts with alpha-synuclein in neuronal tissue and may play a role in the formation of cytoplasmic inclusions and neurodegeneration. A mutation in this gene has been associated with Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acy3 T A 19: 3,987,758 Y88* probably null Het
AI606181 T A 19: 41,593,637 I82N unknown Het
Akap1 T C 11: 88,838,982 Y638C probably damaging Het
Angpt1 T C 15: 42,459,725 N383D probably benign Het
Ank T C 15: 27,571,656 probably null Het
Aoc1 C T 6: 48,905,816 Q209* probably null Het
Apol7c A T 15: 77,525,675 L357* probably null Het
Atxn2l A G 7: 126,493,201 L958P probably damaging Het
Cab39l T A 14: 59,496,946 probably null Het
Cdk5rap2 A G 4: 70,376,787 probably null Het
Cdkn3 T C 14: 46,771,461 S204P unknown Het
Cds2 T C 2: 132,304,480 probably null Het
Cideb C T 14: 55,754,560 R179H probably benign Het
Cped1 A G 6: 22,254,626 Q1006R probably damaging Het
Csmd2 A G 4: 128,456,779 Y1547C Het
Dicer1 A G 12: 104,708,849 L718S probably damaging Het
Dyrk2 T C 10: 118,860,231 H374R possibly damaging Het
Edem2 A T 2: 155,710,966 Y283N probably benign Het
Ero1lb A T 13: 12,600,314 S345C possibly damaging Het
Fam83g T C 11: 61,702,516 V292A possibly damaging Het
Farp2 A G 1: 93,580,119 D513G possibly damaging Het
Fbxl5 A G 5: 43,758,220 W617R probably benign Het
Fzd7 G A 1: 59,483,284 V109M probably damaging Het
Gbp5 A T 3: 142,521,137 H583L probably benign Het
Gm10306 T A 4: 94,556,795 L84M unknown Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gsap A G 5: 21,186,435 T25A probably benign Het
Hectd4 G T 5: 121,329,073 R2466L possibly damaging Het
Ide C A 19: 37,290,785 C557F Het
Igdcc4 T A 9: 65,135,468 C1234* probably null Het
Ints4 A G 7: 97,530,300 I701V probably benign Het
Kalrn T A 16: 34,176,422 I1467F possibly damaging Het
Kcnip3 C A 2: 127,521,336 R2M unknown Het
Kcnrg A T 14: 61,608,082 E190D unknown Het
Klk13 T C 7: 43,721,417 L131P probably damaging Het
Lhcgr A T 17: 88,791,931 L14Q possibly damaging Het
Mdm4 A T 1: 133,011,115 D80E probably damaging Het
Mib2 G T 4: 155,657,893 Q311K probably damaging Het
Mycbp2 A T 14: 103,215,337 S1703T probably damaging Het
Naip6 A T 13: 100,315,503 C200* probably null Het
Ncapd3 T A 9: 27,050,359 I361N probably damaging Het
Nom1 A G 5: 29,435,453 E259G probably benign Het
Olfr16 T A 1: 172,957,106 F104I probably damaging Het
Olfr620 A G 7: 103,611,882 L157P probably damaging Het
Plxna2 A T 1: 194,806,390 H1658L probably damaging Het
Ranbp6 T C 19: 29,812,062 T297A possibly damaging Het
Rap1gap T A 4: 137,728,540 C722* probably null Het
Ribc2 A G 15: 85,135,532 K172E probably benign Het
Scamp5 C A 9: 57,447,140 W77L probably damaging Het
Scin T A 12: 40,080,958 K319* probably null Het
Sec16a G T 2: 26,439,768 T745K probably damaging Het
Slc15a2 G A 16: 36,757,811 A403V probably benign Het
Slco6c1 A G 1: 97,125,741 V145A probably benign Het
Spem1 A G 11: 69,821,804 probably null Het
Spen C T 4: 141,479,135 R727Q unknown Het
Thra T C 11: 98,763,718 S305P probably damaging Het
Tlr1 A G 5: 64,926,724 V170A probably damaging Het
Tmem260 T A 14: 48,505,329 C388* probably null Het
Tmem60 T A 5: 20,886,621 V128D possibly damaging Het
Tpo G A 12: 30,092,686 P680S probably benign Het
Ttc30a2 A T 2: 75,976,196 Y657* probably null Het
Umodl1 A G 17: 30,986,621 E730G possibly damaging Het
Vmn2r69 T C 7: 85,407,107 T608A probably benign Het
Xrra1 G A 7: 99,914,249 S481N possibly damaging Het
Zc3h4 G A 7: 16,429,036 V446I unknown Het
Other mutations in Sncaip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Sncaip APN 18 52884963 splice site probably null
IGL01554:Sncaip APN 18 52868934 missense possibly damaging 0.94
IGL01802:Sncaip APN 18 52869037 missense probably damaging 1.00
IGL02658:Sncaip APN 18 52894955 missense possibly damaging 0.50
IGL02737:Sncaip APN 18 52907056 missense probably benign 0.10
IGL03017:Sncaip APN 18 52894937 missense possibly damaging 0.82
PIT4445001:Sncaip UTSW 18 52868944 missense probably damaging 1.00
R0218:Sncaip UTSW 18 52907328 missense probably benign 0.18
R0325:Sncaip UTSW 18 52905809 missense probably damaging 1.00
R0450:Sncaip UTSW 18 52868709 missense probably benign 0.08
R0469:Sncaip UTSW 18 52868709 missense probably benign 0.08
R1494:Sncaip UTSW 18 52868886 missense probably damaging 0.99
R1897:Sncaip UTSW 18 52894790 splice site probably null
R1962:Sncaip UTSW 18 52871362 missense probably damaging 1.00
R2238:Sncaip UTSW 18 52868547 missense probably damaging 1.00
R2935:Sncaip UTSW 18 52838032 missense probably damaging 1.00
R4044:Sncaip UTSW 18 52907403 missense probably benign 0.01
R4694:Sncaip UTSW 18 52906557 missense probably benign 0.00
R4810:Sncaip UTSW 18 52907199 missense possibly damaging 0.47
R4850:Sncaip UTSW 18 52871384 missense probably damaging 1.00
R4857:Sncaip UTSW 18 52869225 missense probably benign 0.00
R4939:Sncaip UTSW 18 52907263 missense possibly damaging 0.53
R5384:Sncaip UTSW 18 52885041 missense probably damaging 1.00
R5610:Sncaip UTSW 18 52868919 missense probably benign
R5645:Sncaip UTSW 18 52894956 missense probably damaging 1.00
R5797:Sncaip UTSW 18 52898204 missense probably benign 0.28
R5977:Sncaip UTSW 18 52869321 missense probably benign
R6197:Sncaip UTSW 18 52906894 missense probably damaging 1.00
R6369:Sncaip UTSW 18 52868604 missense probably damaging 0.98
R6505:Sncaip UTSW 18 52906537 nonsense probably null
R6604:Sncaip UTSW 18 52905846 missense possibly damaging 0.71
R6880:Sncaip UTSW 18 52869064 missense probably damaging 1.00
R7215:Sncaip UTSW 18 52907343 nonsense probably null
R8523:Sncaip UTSW 18 52838016 missense probably damaging 1.00
Z1177:Sncaip UTSW 18 52907425 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATTCGAATGTGTTCAGTAAGTGTGC -3'
(R):5'- AGGCATCCAGATATTCTGCTC -3'

Sequencing Primer
(F):5'- AATAATTTGCCTCCTGGAATGAAAGG -3'
(R):5'- ATCCAGATATTCTGCTCGACTGGTG -3'
Posted On2019-06-26