Incidental Mutation 'R0577:Klf12'
ID56274
Institutional Source Beutler Lab
Gene Symbol Klf12
Ensembl Gene ENSMUSG00000072294
Gene NameKruppel-like factor 12
Synonyms2700063E05Rik, D530033K05Rik, AP-2rep, B130052C06Rik
MMRRC Submission 038767-MU
Accession Numbers

Ncbi RefSeq: NM_010636.3; MGI:1333796

Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R0577 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location99870632-100284679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100023149 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 48 (Y48F)
Ref Sequence ENSEMBL: ENSMUSP00000153987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097079] [ENSMUST00000226774] [ENSMUST00000228216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097079
AA Change: Y48F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094844
Gene: ENSMUSG00000072294
AA Change: Y48F

DomainStartEndE-ValueType
low complexity region 89 145 N/A INTRINSIC
low complexity region 183 200 N/A INTRINSIC
ZnF_C2H2 317 341 9.58e-3 SMART
ZnF_C2H2 347 371 8.6e-5 SMART
ZnF_C2H2 377 399 9.58e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226774
AA Change: Y48F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228216
AA Change: Y48F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1031 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activator protein-2 alpha (AP-2 alpha) is a developmentally-regulated transcription factor and important regulator of gene expression during vertebrate development and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2 alpha gene by binding to a specific site in the AP-2 alpha gene promoter. Repression by the encoded protein requires binding with a corepressor, CtBP1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(49) : Targeted(1) Gene trapped(48)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Klf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Klf12 APN 14 100149757 missense probably damaging 0.99
IGL01407:Klf12 APN 14 100109858 missense possibly damaging 0.72
IGL01621:Klf12 APN 14 100023149 missense probably damaging 1.00
IGL02746:Klf12 APN 14 99900220 missense probably benign 0.17
IGL02839:Klf12 APN 14 99900239 nonsense probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0212:Klf12 UTSW 14 100022862 missense probably benign
R1980:Klf12 UTSW 14 100149726 splice site probably null
R2017:Klf12 UTSW 14 100022637 missense possibly damaging 0.87
R2282:Klf12 UTSW 14 99900145 missense probably damaging 0.96
R2317:Klf12 UTSW 14 99942067 missense probably benign 0.00
R2901:Klf12 UTSW 14 99900146 missense probably damaging 0.98
R4946:Klf12 UTSW 14 100022957 missense possibly damaging 0.53
R5386:Klf12 UTSW 14 99900159 missense probably damaging 1.00
R5802:Klf12 UTSW 14 100022894 missense probably benign 0.33
R5903:Klf12 UTSW 14 100022688 missense probably damaging 0.99
R6037:Klf12 UTSW 14 99900214 missense probably benign 0.17
R6037:Klf12 UTSW 14 99900214 missense probably benign 0.17
R6753:Klf12 UTSW 14 100109776 nonsense probably null
R8801:Klf12 UTSW 14 100022736 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACCACAGGGATTCGATGAACATGAC -3'
(R):5'- TGTGACCTCTTGTATGAACCAGTGC -3'

Sequencing Primer
(F):5'- CTGTTGACGAAGACGATGCTG -3'
(R):5'- GTGCGTCCTTCCAATGAAAAG -3'
Posted On2013-07-11