Incidental Mutation 'R0577:Gpc6'
ID56275
Institutional Source Beutler Lab
Gene Symbol Gpc6
Ensembl Gene ENSMUSG00000058571
Gene Nameglypican 6
Synonyms6720429C22Rik
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0577 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location116925315-117976544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117436008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 226 (T226A)
Ref Sequence ENSEMBL: ENSMUSP00000120362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078849] [ENSMUST00000088483] [ENSMUST00000125435]
Predicted Effect probably benign
Transcript: ENSMUST00000078849
AA Change: T226A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077893
Gene: ENSMUSG00000058571
AA Change: T226A

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088483
AA Change: T226A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000085835
Gene: ENSMUSG00000058571
AA Change: T226A

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123239
Predicted Effect probably benign
Transcript: ENSMUST00000125435
AA Change: T226A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120362
Gene: ENSMUSG00000058571
AA Change: T226A

DomainStartEndE-ValueType
Pfam:Glypican 15 564 7.2e-248 PFAM
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and they have been implicated in the control of cell growth and cell division. The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, proteases and anti-proteases. Mutations in this gene are associated with omodysplasia 1. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, short long bones, small skull, small snout, cleft palate and decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Gpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gpc6 APN 14 117951234 missense probably benign 0.01
IGL00671:Gpc6 APN 14 117186787 missense probably benign 0.01
IGL00928:Gpc6 APN 14 116925958 missense possibly damaging 0.86
IGL01343:Gpc6 APN 14 117186812 missense possibly damaging 0.54
IGL01545:Gpc6 APN 14 117964830 missense probably damaging 1.00
IGL02797:Gpc6 APN 14 116925982 missense probably damaging 0.98
PIT1430001:Gpc6 UTSW 14 117951182 nonsense probably null
R0611:Gpc6 UTSW 14 117975018 missense probably null
R0636:Gpc6 UTSW 14 117624493 missense probably benign 0.37
R2152:Gpc6 UTSW 14 116926092 missense probably benign 0.00
R2242:Gpc6 UTSW 14 117186787 missense probably benign 0.01
R2266:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2267:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2269:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R3788:Gpc6 UTSW 14 117624466 missense probably damaging 0.98
R4255:Gpc6 UTSW 14 117951141 missense probably benign 0.15
R4276:Gpc6 UTSW 14 117435916 missense probably damaging 0.99
R4411:Gpc6 UTSW 14 117951178 missense probably benign 0.45
R4626:Gpc6 UTSW 14 117964843 nonsense probably null
R4993:Gpc6 UTSW 14 117624539 missense possibly damaging 0.93
R5070:Gpc6 UTSW 14 117186769 missense probably benign 0.01
R6007:Gpc6 UTSW 14 117951261 missense probably damaging 1.00
R6058:Gpc6 UTSW 14 117964770 missense probably damaging 1.00
R6488:Gpc6 UTSW 14 117964713 missense possibly damaging 0.73
R6901:Gpc6 UTSW 14 117951217 missense possibly damaging 0.87
R6981:Gpc6 UTSW 14 117624548 missense probably damaging 0.98
R7200:Gpc6 UTSW 14 117964856 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGCTGGAAAACGCAGAAAAGTCCC -3'
(R):5'- GCCGTCTTGCTTAAACAGCATCACC -3'

Sequencing Primer
(F):5'- TCTTCACTGAGCTAAAGCGG -3'
(R):5'- CCCATGAAAACTCACCTACATTG -3'
Posted On2013-07-11