Incidental Mutation 'R7235:Iscu'
ID562754
Institutional Source Beutler Lab
Gene Symbol Iscu
Ensembl Gene ENSMUSG00000025825
Gene Nameiron-sulfur cluster assembly enzyme
Synonyms2310020H20Rik, Nifun
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R7235 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113772748-113778288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113776882 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 152 (S152T)
Ref Sequence ENSEMBL: ENSMUSP00000107930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000026937] [ENSMUST00000112311] [ENSMUST00000112312] [ENSMUST00000123616] [ENSMUST00000145592] [ENSMUST00000145778]
Predicted Effect probably benign
Transcript: ENSMUST00000019118
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026937
SMART Domains Protein: ENSMUSP00000026937
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 161 3.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112311
AA Change: S152T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107930
Gene: ENSMUSG00000025825
AA Change: S152T

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 1.1e-51 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112312
AA Change: S152T

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107931
Gene: ENSMUSG00000025825
AA Change: S152T

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 3.4e-49 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123616
SMART Domains Protein: ENSMUSP00000117973
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134881
Predicted Effect probably benign
Transcript: ENSMUST00000145592
SMART Domains Protein: ENSMUSP00000123237
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
Pfam:NifU_N 32 136 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145778
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the iron-sulfur (Fe-S) cluster scaffold. Fe-S clusters are cofactors that play a role in the function of a diverse set of enzymes, including those that regulate metabolism, iron homeostasis, and oxidative stress response. Alternative splicing results in transcript variants encoding different protein isoforms that localize either to the cytosol or to the mitochondrion. Mutations in this gene have been found in patients with hereditary myopathy with lactic acidosis. A disease-associated mutation in an intron may activate a cryptic splice site, resulting in the production of a splice variant encoding a putatively non-functional protein. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Catsper4 A T 4: 134,212,581 probably null Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Ddx46 G A 13: 55,663,240 V550I probably benign Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Isl2 C T 9: 55,544,171 T115I probably benign Het
Kalrn T A 16: 34,175,761 T1542S probably benign Het
Kat6a A G 8: 22,914,269 D454G possibly damaging Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Ptk2b G A 14: 66,157,087 Q857* probably null Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Tjp1 T C 7: 65,318,573 D701G probably benign Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Uxs1 T C 1: 43,764,927 N276S probably damaging Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Iscu
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1974:Iscu UTSW 5 113777018 intron probably benign
R4972:Iscu UTSW 5 113776976 intron probably benign
R5210:Iscu UTSW 5 113776973 nonsense probably null
R6805:Iscu UTSW 5 113775243 missense probably damaging 1.00
R7039:Iscu UTSW 5 113776772 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTAGCAGGAGTTCCCTCAG -3'
(R):5'- CTGGAAGAGGCTTAGCAGTGTG -3'

Sequencing Primer
(F):5'- TCAGACAGCCTATCCTGAGGTG -3'
(R):5'- AGCAGTGTGGGAAGGCTCTC -3'
Posted On2019-06-26