Incidental Mutation 'R7235:Selplg'
ID562755
Institutional Source Beutler Lab
Gene Symbol Selplg
Ensembl Gene ENSMUSG00000048163
Gene Nameselectin, platelet (p-selectin) ligand
SynonymsPsgl-1, CD162, Psgl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7235 (G1)
Quality Score214.458
Status Not validated
Chromosome5
Chromosomal Location113818536-113832644 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT at 113819695 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000100874] [ENSMUST00000199109]
Predicted Effect probably benign
Transcript: ENSMUST00000100874
SMART Domains Protein: ENSMUSP00000098436
Gene: ENSMUSG00000048163

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
internal_repeat_2 130 182 2.38e-13 PROSPERO
internal_repeat_1 133 186 5.75e-16 PROSPERO
internal_repeat_1 193 246 5.75e-16 PROSPERO
internal_repeat_2 200 252 2.38e-13 PROSPERO
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199109
Predicted Effect probably benign
Transcript: ENSMUST00000201194
Predicted Effect probably benign
Transcript: ENSMUST00000201931
Predicted Effect probably benign
Transcript: ENSMUST00000202555
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neutrophillia and impaired leukocyte adhesion and rolling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Catsper4 A T 4: 134,212,581 probably null Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Ddx46 G A 13: 55,663,240 V550I probably benign Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Iscu T A 5: 113,776,882 S152T probably benign Het
Isl2 C T 9: 55,544,171 T115I probably benign Het
Kalrn T A 16: 34,175,761 T1542S probably benign Het
Kat6a A G 8: 22,914,269 D454G possibly damaging Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Ptk2b G A 14: 66,157,087 Q857* probably null Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Tjp1 T C 7: 65,318,573 D701G probably benign Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Uxs1 T C 1: 43,764,927 N276S probably damaging Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Selplg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Selplg APN 5 113819468 missense probably damaging 1.00
IGL01488:Selplg APN 5 113819636 missense possibly damaging 0.78
IGL02355:Selplg APN 5 113819406 missense probably benign 0.00
IGL02362:Selplg APN 5 113819406 missense probably benign 0.00
PIT4142001:Selplg UTSW 5 113819628 missense probably benign 0.00
R0375:Selplg UTSW 5 113820008 missense probably damaging 0.99
R1222:Selplg UTSW 5 113819373 missense possibly damaging 0.95
R1840:Selplg UTSW 5 113819844 missense possibly damaging 0.66
R2925:Selplg UTSW 5 113820179 missense possibly damaging 0.92
R4512:Selplg UTSW 5 113819063 missense probably benign 0.05
R4702:Selplg UTSW 5 113819033 missense probably benign 0.31
R4703:Selplg UTSW 5 113819033 missense probably benign 0.31
R4704:Selplg UTSW 5 113819033 missense probably benign 0.31
R4968:Selplg UTSW 5 113819726 missense possibly damaging 0.93
R5075:Selplg UTSW 5 113819984 missense probably benign 0.00
R6159:Selplg UTSW 5 113819101 missense probably benign 0.02
R6345:Selplg UTSW 5 113820149 missense probably benign 0.03
R6550:Selplg UTSW 5 113820149 missense probably benign 0.03
R6554:Selplg UTSW 5 113820149 missense probably benign 0.03
R6997:Selplg UTSW 5 113819695 unclassified probably benign
R7050:Selplg UTSW 5 113819695 unclassified probably benign
R7094:Selplg UTSW 5 113819695 unclassified probably benign
R7481:Selplg UTSW 5 113819695 unclassified probably benign
R7604:Selplg UTSW 5 113819695 unclassified probably benign
R7674:Selplg UTSW 5 113819695 unclassified probably benign
R7846:Selplg UTSW 5 113819420 missense probably damaging 1.00
R7887:Selplg UTSW 5 113819695 unclassified probably benign
R7929:Selplg UTSW 5 113819420 missense probably damaging 1.00
R8051:Selplg UTSW 5 113819441 missense probably damaging 0.99
Z1177:Selplg UTSW 5 113819351 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGCTGCAGACGTTGTAAACAG -3'
(R):5'- GTGGAGTCTAACCTCAGTAGAGAC -3'

Sequencing Primer
(F):5'- TTTACAGCCTGAATCCTGGGAAGC -3'
(R):5'- GTCTAACCTCAGTAGAGACCGTCC -3'
Posted On2019-06-26