Incidental Mutation 'R7235:Tjp1'
ID562763
Institutional Source Beutler Lab
Gene Symbol Tjp1
Ensembl Gene ENSMUSG00000030516
Gene Nametight junction protein 1
SynonymsZO1, ZO-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7235 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location65296165-65527781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65318573 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 701 (D701G)
Ref Sequence ENSEMBL: ENSMUSP00000099652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032729] [ENSMUST00000102592] [ENSMUST00000206612]
PDB Structure
Interplay between phosphatidyl-inositol-phosphates and claudins upon binding to the 1st PDZ domain of zonula occludens 1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000032729
AA Change: D701G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000032729
Gene: ENSMUSG00000030516
AA Change: D701G

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 1157 1176 N/A INTRINSIC
low complexity region 1246 1257 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1339 1365 N/A INTRINSIC
low complexity region 1389 1400 N/A INTRINSIC
ZU5 1549 1654 1.1e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102592
AA Change: D701G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099652
Gene: ENSMUSG00000030516
AA Change: D701G

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
PDZ 32 110 1.65e-15 SMART
PDZ 196 264 3.92e-17 SMART
low complexity region 302 324 N/A INTRINSIC
PDZ 431 504 5.94e-17 SMART
SH3 519 583 6.41e-2 SMART
GuKc 606 794 1.28e-49 SMART
low complexity region 810 824 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 939 955 N/A INTRINSIC
low complexity region 1237 1256 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1388 1399 N/A INTRINSIC
low complexity region 1419 1445 N/A INTRINSIC
low complexity region 1469 1480 N/A INTRINSIC
ZU5 1629 1735 1.84e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206612
AA Change: D701G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein located on a cytoplasmic membrane surface of intercellular tight junctions. The encoded protein may be involved in signal transduction at cell-cell junctions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality and growth retardation, failure of embryo turning and chorioallantoic fusion, defective yolk sac angiogenesis, and increased apoptosis in the notochord, neural tube, somite and allantois. Homozygotes for a reporter allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Catsper4 A T 4: 134,212,581 probably null Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Ddx46 G A 13: 55,663,240 V550I probably benign Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Iscu T A 5: 113,776,882 S152T probably benign Het
Isl2 C T 9: 55,544,171 T115I probably benign Het
Kalrn T A 16: 34,175,761 T1542S probably benign Het
Kat6a A G 8: 22,914,269 D454G possibly damaging Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Ptk2b G A 14: 66,157,087 Q857* probably null Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Uxs1 T C 1: 43,764,927 N276S probably damaging Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Tjp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Tjp1 APN 7 65301219 missense probably benign
IGL00848:Tjp1 APN 7 65303194 missense probably benign 0.00
IGL01363:Tjp1 APN 7 65302965 missense possibly damaging 0.94
IGL01526:Tjp1 APN 7 65322658 missense probably damaging 1.00
IGL01607:Tjp1 APN 7 65336178 missense possibly damaging 0.94
IGL02223:Tjp1 APN 7 65322601 missense probably damaging 1.00
IGL02341:Tjp1 APN 7 65312634 missense probably damaging 1.00
IGL02347:Tjp1 APN 7 65301064 critical splice donor site probably null
IGL02452:Tjp1 APN 7 65312655 missense probably damaging 1.00
IGL02512:Tjp1 APN 7 65343667 missense probably damaging 1.00
IGL02552:Tjp1 APN 7 65299782 nonsense probably null
IGL02707:Tjp1 APN 7 65329683 nonsense probably null
IGL02707:Tjp1 APN 7 65329682 missense possibly damaging 0.85
IGL02939:Tjp1 APN 7 65314890 missense probably damaging 1.00
IGL03139:Tjp1 APN 7 65340434 splice site probably benign
IGL03273:Tjp1 APN 7 65299799 missense probably damaging 1.00
IGL03391:Tjp1 APN 7 65314969 missense probably damaging 1.00
PIT4453001:Tjp1 UTSW 7 65343614 critical splice donor site probably null
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0012:Tjp1 UTSW 7 65329775 splice site probably benign
R0390:Tjp1 UTSW 7 65314990 missense probably damaging 1.00
R0519:Tjp1 UTSW 7 65302921 missense probably benign
R0653:Tjp1 UTSW 7 65314755 missense probably damaging 1.00
R1163:Tjp1 UTSW 7 65323054 missense probably damaging 1.00
R1544:Tjp1 UTSW 7 65302921 missense probably benign
R1634:Tjp1 UTSW 7 65302952 missense possibly damaging 0.94
R1767:Tjp1 UTSW 7 65312553 critical splice donor site probably null
R1771:Tjp1 UTSW 7 65313005 missense probably benign 0.45
R1794:Tjp1 UTSW 7 65323129 missense probably damaging 1.00
R1874:Tjp1 UTSW 7 65319253 missense probably damaging 1.00
R1971:Tjp1 UTSW 7 65324078 missense probably damaging 1.00
R1981:Tjp1 UTSW 7 65312855 missense probably damaging 0.99
R2086:Tjp1 UTSW 7 65312921 missense probably damaging 1.00
R2310:Tjp1 UTSW 7 65329742 missense possibly damaging 0.90
R2942:Tjp1 UTSW 7 65318006 missense probably damaging 1.00
R3974:Tjp1 UTSW 7 65297639 nonsense probably null
R4295:Tjp1 UTSW 7 65323150 missense probably damaging 1.00
R4296:Tjp1 UTSW 7 65318489 missense probably damaging 1.00
R4567:Tjp1 UTSW 7 65306501 missense probably damaging 1.00
R4574:Tjp1 UTSW 7 65322605 missense probably damaging 1.00
R4910:Tjp1 UTSW 7 65343727 missense probably damaging 1.00
R4958:Tjp1 UTSW 7 65336102 nonsense probably null
R5267:Tjp1 UTSW 7 65323049 missense probably damaging 1.00
R5371:Tjp1 UTSW 7 65313311 nonsense probably null
R5422:Tjp1 UTSW 7 65302967 missense probably damaging 0.99
R5514:Tjp1 UTSW 7 65354861 missense probably damaging 1.00
R5652:Tjp1 UTSW 7 65312443 splice site probably null
R5693:Tjp1 UTSW 7 65342663 missense possibly damaging 0.96
R5933:Tjp1 UTSW 7 65302852 missense probably benign 0.29
R6043:Tjp1 UTSW 7 65324089 missense probably damaging 1.00
R6416:Tjp1 UTSW 7 65313205 missense possibly damaging 0.76
R6491:Tjp1 UTSW 7 65337117 missense possibly damaging 0.62
R6525:Tjp1 UTSW 7 65343651 missense probably damaging 1.00
R6658:Tjp1 UTSW 7 65301077 missense possibly damaging 0.82
R6917:Tjp1 UTSW 7 65299688 missense probably damaging 0.99
R6960:Tjp1 UTSW 7 65303015 missense possibly damaging 0.59
R7274:Tjp1 UTSW 7 65527652 missense possibly damaging 0.86
R7471:Tjp1 UTSW 7 65314690 missense probably damaging 0.99
R7475:Tjp1 UTSW 7 65322339 missense probably damaging 1.00
R7479:Tjp1 UTSW 7 65301180 missense probably damaging 0.98
R8035:Tjp1 UTSW 7 65342702 missense probably benign 0.34
X0022:Tjp1 UTSW 7 65302841 missense possibly damaging 0.75
X0027:Tjp1 UTSW 7 65314759 missense probably benign 0.18
Z1177:Tjp1 UTSW 7 65343732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATATAGCTTCCTGGCGC -3'
(R):5'- AGCTTACAAGTGTTATGGCTGAATC -3'

Sequencing Primer
(F):5'- TGGCGCTTTTCCGAGAC -3'
(R):5'- TGAGTTCCAGTACTGCACAG -3'
Posted On2019-06-26