Incidental Mutation 'R0577:Zfp955a'
ID56278
Institutional Source Beutler Lab
Gene Symbol Zfp955a
Ensembl Gene ENSMUSG00000094441
Gene Namezinc finger protein 955A
SynonymsAI842447
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0577 (G1)
Quality Score113
Status Validated
Chromosome17
Chromosomal Location33241519-33255040 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33242094 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 355 (F355I)
Ref Sequence ENSEMBL: ENSMUSP00000008830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008830]
Predicted Effect probably damaging
Transcript: ENSMUST00000008830
AA Change: F355I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000008830
Gene: ENSMUSG00000094441
AA Change: F355I

DomainStartEndE-ValueType
KRAB 10 71 7.08e-15 SMART
ZnF_C2H2 230 252 7.29e0 SMART
ZnF_C2H2 258 280 5.72e-1 SMART
ZnF_C2H2 290 312 6.57e-1 SMART
ZnF_C2HC 291 307 9.75e0 SMART
ZnF_C2H2 318 340 7.67e-2 SMART
ZnF_C2H2 346 368 3.16e-3 SMART
ZnF_C2H2 374 396 1.18e-2 SMART
ZnF_C2H2 402 424 2.99e-4 SMART
ZnF_C2H2 430 452 2.09e-3 SMART
ZnF_C2H2 458 480 6.57e-1 SMART
ZnF_C2HC 459 475 4.03e1 SMART
ZnF_C2H2 486 508 1.28e-3 SMART
ZnF_C2H2 514 536 2.36e-2 SMART
Meta Mutation Damage Score 0.7710 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Other mutations in Zfp955a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Zfp955a APN 17 33242580 nonsense probably null
IGL01859:Zfp955a APN 17 33243719 missense probably benign 0.45
IGL02612:Zfp955a APN 17 33244065 missense probably damaging 0.99
IGL02894:Zfp955a APN 17 33242452 nonsense probably null
IGL02933:Zfp955a APN 17 33243709 splice site probably null
R0145:Zfp955a UTSW 17 33242456 missense probably damaging 0.98
R0963:Zfp955a UTSW 17 33243752 missense probably benign 0.00
R1588:Zfp955a UTSW 17 33241817 missense probably benign 0.00
R1614:Zfp955a UTSW 17 33242332 missense possibly damaging 0.72
R1704:Zfp955a UTSW 17 33241725 nonsense probably null
R1994:Zfp955a UTSW 17 33241646 missense probably damaging 0.99
R2043:Zfp955a UTSW 17 33242553 missense possibly damaging 0.94
R2091:Zfp955a UTSW 17 33242757 nonsense probably null
R2091:Zfp955a UTSW 17 33242757 nonsense probably null
R4077:Zfp955a UTSW 17 33241701 missense probably benign 0.15
R4078:Zfp955a UTSW 17 33241701 missense probably benign 0.15
R4689:Zfp955a UTSW 17 33242066 missense probably damaging 1.00
R4735:Zfp955a UTSW 17 33241722 missense probably benign 0.09
R4870:Zfp955a UTSW 17 33241725 nonsense probably null
R4904:Zfp955a UTSW 17 33242188 nonsense probably null
R5180:Zfp955a UTSW 17 33242618 missense probably benign 0.15
R6006:Zfp955a UTSW 17 33241686 missense probably damaging 1.00
R7132:Zfp955a UTSW 17 33241615 nonsense probably null
R7403:Zfp955a UTSW 17 33243746 missense probably benign 0.01
R7457:Zfp955a UTSW 17 33244051 nonsense probably null
R7547:Zfp955a UTSW 17 33242823 missense probably benign 0.05
X0062:Zfp955a UTSW 17 33242002 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CCAATGGGTTTCTTTCCATGACCGAG -3'
(R):5'- TGGTGAAACTTTCCTGTATTCCAAGGC -3'

Sequencing Primer
(F):5'- catgtatagggcttctctccag -3'
(R):5'- AAGGCCTGTCGTGATCATG -3'
Posted On2013-07-11