Incidental Mutation 'R7235:Ddx46'
ID562785
Institutional Source Beutler Lab
Gene Symbol Ddx46
Ensembl Gene ENSMUSG00000021500
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7235 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55635027-55681256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55663240 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 550 (V550I)
Ref Sequence ENSEMBL: ENSMUSP00000133245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099479] [ENSMUST00000172272] [ENSMUST00000223736]
Predicted Effect probably benign
Transcript: ENSMUST00000099479
AA Change: V546I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097078
Gene: ENSMUSG00000021500
AA Change: V546I

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 4e-76 BLAST
DEXDc 391 592 3.27e-49 SMART
HELICc 629 710 1.55e-27 SMART
low complexity region 760 776 N/A INTRINSIC
low complexity region 798 813 N/A INTRINSIC
internal_repeat_1 855 894 6.68e-7 PROSPERO
low complexity region 911 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172272
AA Change: V550I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133245
Gene: ENSMUSG00000021500
AA Change: V550I

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 5e-76 BLAST
DEXDc 391 596 8.03e-67 SMART
HELICc 633 714 1.55e-27 SMART
low complexity region 764 780 N/A INTRINSIC
low complexity region 802 817 N/A INTRINSIC
internal_repeat_1 859 898 1.04e-6 PROSPERO
low complexity region 915 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223736
AA Change: V550I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the 17S U2 snRNP complex; it plays an important role in pre-mRNA splicing. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Catsper4 A T 4: 134,212,581 probably null Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Iscu T A 5: 113,776,882 S152T probably benign Het
Isl2 C T 9: 55,544,171 T115I probably benign Het
Kalrn T A 16: 34,175,761 T1542S probably benign Het
Kat6a A G 8: 22,914,269 D454G possibly damaging Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Ptk2b G A 14: 66,157,087 Q857* probably null Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Tjp1 T C 7: 65,318,573 D701G probably benign Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Uxs1 T C 1: 43,764,927 N276S probably damaging Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Ddx46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Ddx46 APN 13 55666332 nonsense probably null
IGL01137:Ddx46 APN 13 55669717 nonsense probably null
IGL01432:Ddx46 APN 13 55638022 splice site probably benign
IGL01575:Ddx46 APN 13 55654183 splice site probably benign
IGL01673:Ddx46 APN 13 55653048 missense probably damaging 1.00
IGL01868:Ddx46 APN 13 55639870 nonsense probably null
IGL01945:Ddx46 APN 13 55655072 nonsense probably null
IGL02106:Ddx46 APN 13 55677603 unclassified probably benign
IGL03288:Ddx46 APN 13 55638094 missense unknown
R0270:Ddx46 UTSW 13 55674104 missense probably benign 0.00
R0631:Ddx46 UTSW 13 55639777 splice site probably benign
R1082:Ddx46 UTSW 13 55655096 missense possibly damaging 0.87
R1502:Ddx46 UTSW 13 55663309 missense possibly damaging 0.89
R2081:Ddx46 UTSW 13 55674016 missense probably benign 0.00
R2256:Ddx46 UTSW 13 55647708 missense possibly damaging 0.50
R4366:Ddx46 UTSW 13 55663236 missense probably benign 0.10
R4856:Ddx46 UTSW 13 55638199 missense unknown
R4886:Ddx46 UTSW 13 55638199 missense unknown
R5001:Ddx46 UTSW 13 55652919 missense probably damaging 0.98
R5152:Ddx46 UTSW 13 55659030 missense probably damaging 1.00
R5258:Ddx46 UTSW 13 55653024 missense possibly damaging 0.95
R5278:Ddx46 UTSW 13 55676038 missense probably damaging 0.97
R5806:Ddx46 UTSW 13 55663337 missense possibly damaging 0.93
R6627:Ddx46 UTSW 13 55652935 missense probably benign 0.15
R6659:Ddx46 UTSW 13 55669724 missense probably damaging 1.00
R6838:Ddx46 UTSW 13 55639935 critical splice donor site probably null
R7537:Ddx46 UTSW 13 55650478 missense probably damaging 1.00
R7664:Ddx46 UTSW 13 55659051 missense probably damaging 1.00
R7673:Ddx46 UTSW 13 55659159 missense probably benign 0.01
R7704:Ddx46 UTSW 13 55674019 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGTTGCAGATGTTGGCCAG -3'
(R):5'- GCCTTCCTGAACATGGTACC -3'

Sequencing Primer
(F):5'- AGATGTTGGCCAGTGAGCC -3'
(R):5'- GGTACCTACCACCTGCTGTTC -3'
Posted On2019-06-26