Incidental Mutation 'R7235:Ptk2b'
ID562787
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene NamePTK2 protein tyrosine kinase 2 beta
SynonymsCAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R7235 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location66153257-66281052 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 66157087 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 857 (Q857*)
Ref Sequence ENSEMBL: ENSMUSP00000137008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]
Predicted Effect probably benign
Transcript: ENSMUST00000022620
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022622
AA Change: Q857*
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: Q857*

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089250
AA Change: Q815*
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456
AA Change: Q815*

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111121
AA Change: Q853*
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: Q853*

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154865
AA Change: Q229*
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456
AA Change: Q229*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178730
AA Change: Q857*
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: Q857*

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Catsper4 A T 4: 134,212,581 probably null Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Ddx46 G A 13: 55,663,240 V550I probably benign Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Iscu T A 5: 113,776,882 S152T probably benign Het
Isl2 C T 9: 55,544,171 T115I probably benign Het
Kalrn T A 16: 34,175,761 T1542S probably benign Het
Kat6a A G 8: 22,914,269 D454G possibly damaging Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Tjp1 T C 7: 65,318,573 D701G probably benign Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Uxs1 T C 1: 43,764,927 N276S probably damaging Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66177118 missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66158613 missense probably benign 0.00
IGL02121:Ptk2b APN 14 66213482 missense probably benign 0.12
IGL02505:Ptk2b APN 14 66154243 missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66173895 splice site probably benign
IGL03343:Ptk2b APN 14 66169421 missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66156381 missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66213372 missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66172144 missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66177751 missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66158598 missense probably benign 0.02
R1502:Ptk2b UTSW 14 66163080 missense possibly damaging 0.95
R1583:Ptk2b UTSW 14 66163114 missense possibly damaging 0.75
R1876:Ptk2b UTSW 14 66158392 missense probably benign 0.01
R1905:Ptk2b UTSW 14 66158670 missense probably damaging 1.00
R1942:Ptk2b UTSW 14 66169381 missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66172505 missense probably benign 0.28
R2377:Ptk2b UTSW 14 66172548 missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66178183 splice site probably null
R3793:Ptk2b UTSW 14 66170251 missense probably damaging 1.00
R3836:Ptk2b UTSW 14 66156342 missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66157068 missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66163047 missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66173300 splice site probably null
R4691:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4692:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4693:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4847:Ptk2b UTSW 14 66173882 missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66156415 missense probably damaging 1.00
R5297:Ptk2b UTSW 14 66172517 missense probably benign 0.04
R5603:Ptk2b UTSW 14 66172065 nonsense probably null
R5935:Ptk2b UTSW 14 66173879 missense probably damaging 1.00
R6245:Ptk2b UTSW 14 66163066 missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66178831 missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66187474 missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66213398 missense probably damaging 1.00
R7511:Ptk2b UTSW 14 66154244 missense possibly damaging 0.81
R7558:Ptk2b UTSW 14 66154179 missense possibly damaging 0.83
R7838:Ptk2b UTSW 14 66158401 missense probably benign
R7921:Ptk2b UTSW 14 66158401 missense probably benign
X0054:Ptk2b UTSW 14 66213328 missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66154094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGCGATGAAGCCTGACC -3'
(R):5'- TTTGAAAGCCTTGGACAGATCTTG -3'

Sequencing Primer
(F):5'- CCTGACCTGAAACTGGATGCATG -3'
(R):5'- GGAAGACCAAGATCCTATTTCCTTGG -3'
Posted On2019-06-26