Incidental Mutation 'R0577:Pias2'
ID56279
Institutional Source Beutler Lab
Gene Symbol Pias2
Ensembl Gene ENSMUSG00000025423
Gene Nameprotein inhibitor of activated STAT 2
SynonymsARIP3, Miz1, PIASxalpha, PIASxbeta, Dib, 6330408K17Rik, PIASxb
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0577 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location77065208-77155708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77097281 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 12 (L12F)
Ref Sequence ENSEMBL: ENSMUSP00000131485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114776] [ENSMUST00000114777] [ENSMUST00000168882]
Predicted Effect probably damaging
Transcript: ENSMUST00000114776
AA Change: L12F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110424
Gene: ENSMUSG00000025423
AA Change: L12F

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 7e-45 PFAM
Pfam:zf-MIZ 335 384 4.9e-24 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114777
AA Change: L19F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110425
Gene: ENSMUSG00000025423
AA Change: L19F

DomainStartEndE-ValueType
SAP 11 45 2.01e-5 SMART
low complexity region 102 117 N/A INTRINSIC
low complexity region 135 144 N/A INTRINSIC
Pfam:PINIT 145 297 4.8e-38 PFAM
Pfam:zf-MIZ 342 391 1.7e-24 PFAM
low complexity region 475 483 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 571 610 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168882
AA Change: L12F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131485
Gene: ENSMUSG00000025423
AA Change: L12F

DomainStartEndE-ValueType
SAP 4 38 2.01e-5 SMART
low complexity region 95 110 N/A INTRINSIC
Pfam:PINIT 134 290 2.3e-44 PFAM
Pfam:zf-MIZ 335 384 2.6e-23 PFAM
low complexity region 468 476 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
low complexity region 564 603 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Isoforms of the encoded protein enhance the sumoylation of specific target proteins including the p53 tumor suppressor protein, c-Jun, and the androgen receptor. A pseudogene of this gene is located on the short arm of chromosome 4. The symbol MIZ1 has also been associated with ZBTB17 which is a different gene located on chromosome 1. [provided by RefSeq, Aug 2011]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype although abnormalities are reported in the testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Pias2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Pias2 APN 18 77133211 missense probably damaging 1.00
IGL01105:Pias2 APN 18 77133156 missense probably damaging 1.00
IGL02379:Pias2 APN 18 77145148 splice site probably benign
IGL02932:Pias2 APN 18 77145103 missense probably damaging 1.00
IGL03181:Pias2 APN 18 77133242 missense possibly damaging 0.83
IGL03389:Pias2 APN 18 77097658 missense probably damaging 1.00
IGL03138:Pias2 UTSW 18 77150100 critical splice donor site probably null
R0492:Pias2 UTSW 18 77105885 missense probably damaging 1.00
R1660:Pias2 UTSW 18 77120129 missense probably damaging 1.00
R1866:Pias2 UTSW 18 77152716 missense probably benign 0.03
R1901:Pias2 UTSW 18 77097443 nonsense probably null
R1996:Pias2 UTSW 18 77129063 critical splice donor site probably null
R2107:Pias2 UTSW 18 77097471 missense probably benign 0.35
R4439:Pias2 UTSW 18 77097703 missense probably damaging 1.00
R4603:Pias2 UTSW 18 77130107 missense probably damaging 0.99
R4747:Pias2 UTSW 18 77152792 makesense probably null
R4816:Pias2 UTSW 18 77105891 critical splice donor site probably null
R5697:Pias2 UTSW 18 77133188 missense probably damaging 1.00
R6265:Pias2 UTSW 18 77097258 missense probably damaging 1.00
R6375:Pias2 UTSW 18 77152670 missense possibly damaging 0.96
R6545:Pias2 UTSW 18 77130085 missense possibly damaging 0.61
R6713:Pias2 UTSW 18 77065720 utr 5 prime probably null
R7193:Pias2 UTSW 18 77120121 missense possibly damaging 0.76
R7232:Pias2 UTSW 18 77133235 missense probably benign 0.02
R7253:Pias2 UTSW 18 77120115 missense probably damaging 0.97
R7259:Pias2 UTSW 18 77152720 missense possibly damaging 0.73
X0009:Pias2 UTSW 18 77145097 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCTTTAGATCACAGGTAGAGTTGGA -3'
(R):5'- AGTGTCTTGCAGCAGTACAGAACC -3'

Sequencing Primer
(F):5'- TTCCAAGAGGAGATAGCTTCTG -3'
(R):5'- TGATGAGCTACCATCCAAGCTG -3'
Posted On2013-07-11