Mutagenetix > Incidental Mutation

Incidental Mutation 'R7235:Kalrn'

562791

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

045305-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R7235 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34175761 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1542 (T1542S)

Ref Sequence

ENSEMBL: ENSMUSP00000110611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076810
AA Change: T1524S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: T1524S

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000089655
AA Change: T1551S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: T1551S

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114947

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114949
AA Change: T901S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: T901S

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114953
AA Change: T910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: T910S

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114954
AA Change: T910S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: T910S

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114960
AA Change: T1542S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: T1542S

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: T1519S

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151491
AA Change: T1298S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: T1298S

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	T	G	2: 85,500,219	H248P	probably damaging	Het
Ahnak	T	A	19: 9,012,488	M3712K	unknown	Het
Bri3bp	A	G	5: 125,441,684	E8G	unknown	Het
Brip1	C	T	11: 86,138,875	R611Q	possibly damaging	Het
C330027C09Rik	T	A	16: 49,001,059	L176H	probably damaging	Het
Carm1	T	G	9: 21,587,405		probably benign	Het
Catsper4	A	T	4: 134,212,581		probably null	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Clk4	A	G	11: 51,276,185	D330G	probably damaging	Het
Dcdc2c	A	G	12: 28,470,719	S453P		Het
Ddx46	G	A	13: 55,663,240	V550I	probably benign	Het
Dennd1a	T	C	2: 37,801,061	N676D	probably benign	Het
Dnah3	T	C	7: 120,032,670	N1365S	probably damaging	Het
Dsg1b	T	C	18: 20,399,423	V508A	probably benign	Het
Dus2	T	C	8: 106,015,955	V39A	possibly damaging	Het
Dync1li1	T	C	9: 114,715,163	V301A	possibly damaging	Het
Efcc1	T	G	6: 87,753,798	S513A	probably benign	Het
Eif3f	T	C	7: 108,938,088	V167A	possibly damaging	Het
Ephb2	A	G	4: 136,693,828	Y404H	probably damaging	Het
Eqtn	A	T	4: 94,923,699	D152E	probably damaging	Het
Ercc5	A	C	1: 44,178,203	K902T	possibly damaging	Het
Erlec1	T	A	11: 30,950,751	E139V	possibly damaging	Het
Evl	G	A	12: 108,648,460	G38R	probably damaging	Het
Foxd2	T	C	4: 114,908,271	N184S	unknown	Het
Frem3	T	C	8: 80,690,725	Y2020H	probably benign	Het
Ganc	T	C	2: 120,433,717	F384L	probably damaging	Het
Gm11756	G	T	4: 73,917,571	L219M	probably benign	Het
Grin2a	A	G	16: 9,579,265	L986P	probably damaging	Het
Ift140	A	T	17: 25,020,645	D92V	possibly damaging	Het
Inpp5b	A	G	4: 124,751,392	K158E	probably benign	Het
Iscu	T	A	5: 113,776,882	S152T	probably benign	Het
Isl2	C	T	9: 55,544,171	T115I	probably benign	Het
Kat6a	A	G	8: 22,914,269	D454G	possibly damaging	Het
Kcnj10	T	C	1: 172,369,426	I169T	probably damaging	Het
Klk12	T	C	7: 43,773,299	S217P	probably damaging	Het
Lancl1	T	C	1: 67,038,535	N14S	probably benign	Het
Map2	A	G	1: 66,414,648	Y899C	probably damaging	Het
Nr1h5	C	T	3: 102,949,042		probably null	Het
Nup98	T	C	7: 102,125,284	T1515A	probably damaging	Het
Obscn	A	C	11: 59,080,840	V2183G	probably damaging	Het
Olfr666	C	T	7: 104,892,719	R303Q	probably benign	Het
Osbpl8	A	G	10: 111,269,427	T248A	probably benign	Het
Pias3	T	A	3: 96,704,363	S533T	probably benign	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plxna1	A	G	6: 89,340,591	Y680H	probably damaging	Het
Pnliprp2	A	G	19: 58,775,227	N436S	probably benign	Het
Pold1	T	A	7: 44,541,820	M196L	probably benign	Het
Prkdc	G	A	16: 15,714,263	V1464I	probably benign	Het
Ptk2b	G	A	14: 66,157,087	Q857*	probably null	Het
Qars	T	A	9: 108,510,132	L185Q	probably damaging	Het
Rabep1	A	G	11: 70,940,464	N859S	probably benign	Het
Rnf19b	A	G	4: 129,083,778	H156R		Het
Sart3	T	C	5: 113,753,642	Q423R	probably damaging	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Slc6a21	C	T	7: 45,280,758	H194Y	probably damaging	Het
Tcf4	G	A	18: 69,657,795	V420I	probably damaging	Het
Tjp1	T	C	7: 65,318,573	D701G	probably benign	Het
Trim42	T	C	9: 97,369,708	D46G	probably damaging	Het
Usp19	C	T	9: 108,494,924	R429*	probably null	Het
Uxs1	T	C	1: 43,764,927	N276S	probably damaging	Het
Vps50	A	G	6: 3,588,078	I684V	probably benign	Het
Yars2	T	A	16: 16,304,692	D307E	probably benign	Het
Zfp934	A	T	13: 62,518,150	C258S		Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34175722	splice site	probably benign
IGL01364:Kalrn	APN	16	34262629	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34235330	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34294161	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34198512	splice site	probably null
IGL02059:Kalrn	APN	16	34252341	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34220222	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34310527	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34332224	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34360846	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34513959	nonsense	probably null
IGL02696:Kalrn	APN	16	34220114	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34392050	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34220130	nonsense	probably null
IGL03188:Kalrn	APN	16	34314192	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34385297	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34314176	missense	probably damaging	0.99
breeze	UTSW	16	34013675	missense
ethereal	UTSW	16	33975435	utr 3 prime	probably benign
Feather	UTSW	16	34314209	missense	probably damaging	0.99
Hidden	UTSW	16	34027976	missense	probably damaging	1.00
Soulful	UTSW	16	34187484	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34031582	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34198514	splice site	probably benign
R0043:Kalrn	UTSW	16	34054906	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34357171	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34031590	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34049936	intron	probably benign
R0183:Kalrn	UTSW	16	34171379	splice site	probably null
R0422:Kalrn	UTSW	16	34314273	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34054891	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33993670	splice site	probably benign
R0656:Kalrn	UTSW	16	34032467	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34116408	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34010581	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34035554	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34049919	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34385390	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34016498	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33988803	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34212820	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33975754	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34174487	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34314278	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34010548	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34360950	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34212873	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34294215	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34356961	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33975923	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33977524	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34028045	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34189736	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34252310	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34332143	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34332230	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34307724	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34009262	unclassified	probably benign
R2193:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34176262	splice site	probably null
R2404:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34310495	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34212272	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34357315	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34392030	splice site	probably null
R3788:Kalrn	UTSW	16	34220240	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34039889	nonsense	probably null
R3871:Kalrn	UTSW	16	34203856	splice site	probably null
R3934:Kalrn	UTSW	16	34310531	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34235391	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33987208	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34392042	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34235267	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34513926	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34028705	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34176391	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34198487	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34356969	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34514019	unclassified	probably benign
R4888:Kalrn	UTSW	16	34171330	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34357415	splice site	probably null
R5030:Kalrn	UTSW	16	33975742	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34314352	nonsense	probably null
R5117:Kalrn	UTSW	16	34033601	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34252341	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34262653	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34053622	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34175780	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34039934	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34014084	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34016579	missense	probably benign
R5716:Kalrn	UTSW	16	33987176	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33975820	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34212249	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33987091	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33975435	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34243833	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34357343	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34010580	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34360885	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33985191	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34212885	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34357111	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34053639	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34055071	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33975991	missense	probably benign
R6397:Kalrn	UTSW	16	33992985	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34332164	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34205302	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34360984	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34182747	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34217923	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34027976	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33975703	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34220136	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34357048	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34217891	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34256227	missense	unknown
R7154:Kalrn	UTSW	16	34212157	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34163077	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34176422	missense	possibly damaging	0.63
R7504:Kalrn	UTSW	16	34256233	missense	unknown
R7563:Kalrn	UTSW	16	34392094	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34314212	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34031582	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34187484	nonsense	probably null
R7867:Kalrn	UTSW	16	33989791	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33988847	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34028752	missense	probably benign
R8080:Kalrn	UTSW	16	33975668	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34055044	missense	probably benign
R8239:Kalrn	UTSW	16	34049783	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34035061	nonsense	probably null
R8294:Kalrn	UTSW	16	34033584	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34360935	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34034514	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33982855	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34198460	missense	probably benign	0.05
R8878:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R8880:Kalrn	UTSW	16	34217935	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33993655	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34227126	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34034484	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34361001	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34013675	missense
R9424:Kalrn	UTSW	16	33988818	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34095879	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33985230	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34028827	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34212213	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34039933	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34035506	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGAATATCTGCCTTCAAGATTC -3'
(R):5'- TGATTGACAGAAGCCCCTCC -3'

Sequencing Primer
(F):5'- GAATATCTGCCTTCAAGATTCTGGGC -3'
(R):5'- ACAGAAGCCCCTCCCTTGG -3'

Posted On

2019-06-26