Incidental Mutation 'R0577:Eef1g'
ID56280
Institutional Source Beutler Lab
Gene Symbol Eef1g
Ensembl Gene ENSMUSG00000071644
Gene Nameeukaryotic translation elongation factor 1 gamma
SynonymsEF1G, 2610301D06Rik
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R0577 (G1)
Quality Score199
Status Validated
Chromosome19
Chromosomal Location8967041-8978479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8973042 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 264 (D264G)
Ref Sequence ENSEMBL: ENSMUSP00000093955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052248]
Predicted Effect probably benign
Transcript: ENSMUST00000052248
AA Change: D264G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000093955
Gene: ENSMUSG00000071644
AA Change: D264G

DomainStartEndE-ValueType
Pfam:GST_N 2 81 1.5e-25 PFAM
Pfam:GST_N_3 6 83 1.4e-8 PFAM
Pfam:GST_C_3 88 194 8.3e-13 PFAM
Pfam:GST_C 106 198 4.5e-22 PFAM
Pfam:GST_C_2 125 191 8.6e-12 PFAM
low complexity region 238 262 N/A INTRINSIC
EF1G 275 381 3.63e-78 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152076
Meta Mutation Damage Score 0.1742 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit contains an N-terminal glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing this elongation factor and aminoacyl-tRNA synthetases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Eef1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1871:Eef1g UTSW 19 8977966 missense possibly damaging 0.80
R3946:Eef1g UTSW 19 8969977 missense probably benign 0.23
R4698:Eef1g UTSW 19 8977966 missense possibly damaging 0.70
R6112:Eef1g UTSW 19 8977591 missense probably damaging 1.00
R6672:Eef1g UTSW 19 8967047 utr 5 prime probably null
R6944:Eef1g UTSW 19 8968292 missense probably benign
R7665:Eef1g UTSW 19 8968289 missense probably benign 0.19
R7725:Eef1g UTSW 19 8978063 missense probably benign 0.00
R7836:Eef1g UTSW 19 8977374 missense probably benign 0.10
R7919:Eef1g UTSW 19 8977374 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTCAACCCTTTGACTTGCATAGCC -3'
(R):5'- AACCTGGACACATGAGACCTGGAC -3'

Sequencing Primer
(F):5'- TTGTTCACCCAGAGAACGTG -3'
(R):5'- ggacacatgagacctggACTATAC -3'
Posted On2013-07-11