Incidental Mutation 'R0577:Olfr1504'
ID56281
Institutional Source Beutler Lab
Gene Symbol Olfr1504
Ensembl Gene ENSMUSG00000059105
Gene Nameolfactory receptor 1504
SynonymsMOR212-2, GA_x6K02T2RE5P-4223635-4222688
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0577 (G1)
Quality Score197
Status Validated
Chromosome19
Chromosomal Location13886920-13897928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13887803 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000146610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078282] [ENSMUST00000209192]
Predicted Effect probably damaging
Transcript: ENSMUST00000078282
AA Change: T136A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077400
Gene: ENSMUSG00000059105
AA Change: T136A

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.3e-46 PFAM
Pfam:7tm_1 40 313 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209192
AA Change: T136A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Abcc2 A T 19: 43,819,401 D827V probably damaging Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Olfr1504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1504 APN 19 13887581 missense probably benign
IGL00885:Olfr1504 APN 19 13888168 missense probably benign 0.17
IGL01084:Olfr1504 APN 19 13887502 missense probably damaging 1.00
IGL01522:Olfr1504 APN 19 13887358 nonsense probably null
IGL01727:Olfr1504 APN 19 13887878 missense probably damaging 0.98
IGL02440:Olfr1504 APN 19 13887859 missense probably damaging 1.00
IGL03342:Olfr1504 APN 19 13887437 missense probably damaging 1.00
R0531:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
R1028:Olfr1504 UTSW 19 13887795 missense probably damaging 0.97
R1674:Olfr1504 UTSW 19 13887590 missense probably benign 0.01
R3906:Olfr1504 UTSW 19 13887706 missense probably damaging 1.00
R4598:Olfr1504 UTSW 19 13888017 missense probably damaging 1.00
R4658:Olfr1504 UTSW 19 13887548 missense probably benign 0.19
R4676:Olfr1504 UTSW 19 13887401 missense probably damaging 1.00
R5919:Olfr1504 UTSW 19 13887845 missense probably damaging 1.00
R5943:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTTGGTCTCACTACAGGCAAGCTTC -3'
(R):5'- TAATTCAGAGTGACCCTCGGCTCC -3'

Sequencing Primer
(F):5'- TACAGGCAAGCTTCATCAGG -3'
(R):5'- CATCTGTTATTGTGCCACAGC -3'
Posted On2013-07-11