Incidental Mutation 'R7236:Ptpro'
ID 562817
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase receptor type O
Synonyms Ptpn15, PTP-BK, D28, PTPROt, PTP-phi, PTP-U2, GLEPP1, PTP-oc
MMRRC Submission 045306-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7236 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 137229317-137440231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 137345335 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 114 (V114M)
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167679]
AlphaFold E9Q612
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: V114M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V114M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: V114M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V114M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 C T 19: 4,921,644 (GRCm39) V179I probably benign Het
Adra1b A G 11: 43,667,151 (GRCm39) I362T possibly damaging Het
B3galnt1 T C 3: 69,482,950 (GRCm39) K104E probably benign Het
Bnc2 T C 4: 84,474,101 (GRCm39) Y15C probably benign Het
C2cd2l C A 9: 44,228,960 (GRCm39) A124S possibly damaging Het
Camsap3 T A 8: 3,654,116 (GRCm39) F595L probably damaging Het
Cct2 A T 10: 116,897,464 (GRCm39) D93E probably benign Het
Cd200l2 A T 16: 45,348,030 (GRCm39) I169N possibly damaging Het
Cemip A T 7: 83,598,012 (GRCm39) probably null Het
Ciapin1 T C 8: 95,550,338 (GRCm39) T34A Het
Dop1a G A 9: 86,397,431 (GRCm39) V912I probably damaging Het
Efcab3 A T 11: 104,790,093 (GRCm39) Q2832L probably benign Het
Eif3c T C 7: 126,151,495 (GRCm39) T610A possibly damaging Het
Ephb3 A G 16: 21,033,231 (GRCm39) R106G probably damaging Het
Ephx3 T A 17: 32,404,328 (GRCm39) probably null Het
Etv2 A T 7: 30,334,455 (GRCm39) S93T probably benign Het
Fbxo34 T A 14: 47,767,841 (GRCm39) D451E probably benign Het
Fmo9 A G 1: 166,504,140 (GRCm39) F141L probably damaging Het
Fryl T C 5: 73,265,821 (GRCm39) K500R possibly damaging Het
Gfra3 T C 18: 34,828,884 (GRCm39) D170G probably damaging Het
Gnptg T C 17: 25,458,897 (GRCm39) N34S possibly damaging Het
Golga5 T A 12: 102,441,034 (GRCm39) probably null Het
Herc2 G T 7: 55,734,828 (GRCm39) L139F probably benign Het
Ikzf2 T A 1: 69,578,240 (GRCm39) N423I probably benign Het
Il31ra A T 13: 112,660,439 (GRCm39) *717R probably null Het
Itga2 G T 13: 115,014,227 (GRCm39) Q234K probably benign Het
Kcnt1 A T 2: 25,799,951 (GRCm39) probably null Het
Kif19b G T 5: 140,457,400 (GRCm39) A390S probably benign Het
Man2a2 T C 7: 80,018,653 (GRCm39) S69G probably damaging Het
Mccc1 A G 3: 36,037,944 (GRCm39) V294A probably benign Het
Mphosph8 T A 14: 56,911,754 (GRCm39) I259K possibly damaging Het
Mrpl15 A T 1: 4,846,711 (GRCm39) N288K probably benign Het
Msantd2 T C 9: 37,400,965 (GRCm39) W116R probably damaging Het
Msantd5f9 G T 4: 73,835,808 (GRCm39) L219M probably benign Het
Mtmr10 T C 7: 63,963,932 (GRCm39) probably benign Het
Mylk A T 16: 34,742,899 (GRCm39) D1137V probably damaging Het
Nhsl1 A G 10: 18,401,512 (GRCm39) K879E probably damaging Het
Or8j3c A T 2: 86,253,533 (GRCm39) C162* probably null Het
Pak6 A G 2: 118,523,909 (GRCm39) T355A probably benign Het
Patj C T 4: 98,299,294 (GRCm39) R139C probably damaging Het
Pcdhb3 C T 18: 37,434,505 (GRCm39) A157V probably damaging Het
Phkg1 C A 5: 129,895,802 (GRCm39) D150Y probably damaging Het
Ppp2r5c C T 12: 110,432,323 (GRCm39) S45L probably benign Het
Prl4a1 A C 13: 28,202,556 (GRCm39) T44P probably benign Het
Pwp1 A G 10: 85,715,147 (GRCm39) N211S probably benign Het
Ralgapb A G 2: 158,282,747 (GRCm39) D504G probably benign Het
Rock2 A T 12: 16,979,003 (GRCm39) I98F probably damaging Het
Senp6 G T 9: 80,040,247 (GRCm39) V785L probably damaging Het
Simc1 A G 13: 54,672,609 (GRCm39) D319G probably benign Het
Tas2r105 A T 6: 131,663,723 (GRCm39) I235N probably damaging Het
Tas2r110 A T 6: 132,845,667 (GRCm39) M233L possibly damaging Het
Tmem260 C T 14: 48,746,647 (GRCm39) probably null Het
Trank1 G T 9: 111,202,142 (GRCm39) V1590L possibly damaging Het
Tsc2 A T 17: 24,842,568 (GRCm39) M286K possibly damaging Het
Ttn T C 2: 76,697,796 (GRCm39) T202A Het
Ttyh1 A G 7: 4,136,663 (GRCm39) N424D probably benign Het
Usp24 T A 4: 106,263,502 (GRCm39) probably null Het
Utp20 G T 10: 88,585,204 (GRCm39) P2620Q probably benign Het
Vmn1r45 A G 6: 89,910,133 (GRCm39) M279T probably benign Het
Vmn2r115 T A 17: 23,578,576 (GRCm39) I683K probably benign Het
Vmn2r34 T C 7: 7,684,750 (GRCm39) K481E probably damaging Het
Vmn2r54 T A 7: 12,365,917 (GRCm39) H339L possibly damaging Het
Vmn2r94 T A 17: 18,477,811 (GRCm39) N200I possibly damaging Het
Wdfy3 A G 5: 101,984,074 (GRCm39) Y3493H probably damaging Het
Wdr5b A G 16: 35,862,208 (GRCm39) D109G possibly damaging Het
Zfp286 A T 11: 62,674,496 (GRCm39) probably null Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137,371,907 (GRCm39) critical splice donor site probably null
IGL00844:Ptpro APN 6 137,391,237 (GRCm39) missense probably damaging 1.00
IGL00983:Ptpro APN 6 137,395,246 (GRCm39) missense probably benign 0.01
IGL01073:Ptpro APN 6 137,354,086 (GRCm39) missense probably damaging 1.00
IGL01832:Ptpro APN 6 137,370,666 (GRCm39) missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137,431,698 (GRCm39) missense probably benign 0.37
IGL02387:Ptpro APN 6 137,387,978 (GRCm39) missense probably damaging 0.96
IGL02605:Ptpro APN 6 137,357,316 (GRCm39) missense probably benign 0.02
IGL02666:Ptpro APN 6 137,355,057 (GRCm39) missense probably damaging 0.96
IGL03275:Ptpro APN 6 137,427,004 (GRCm39) missense probably damaging 1.00
Brau UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
court UTSW 6 137,370,673 (GRCm39) nonsense probably null
Hoff UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
Jester UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
mann UTSW 6 137,388,114 (GRCm39) splice site probably null
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0020:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0022:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0023:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0024:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0103:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0106:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0316:Ptpro UTSW 6 137,353,987 (GRCm39) missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137,345,294 (GRCm39) missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137,391,228 (GRCm39) missense probably benign 0.04
R0536:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0537:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0552:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0555:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0664:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0708:Ptpro UTSW 6 137,363,251 (GRCm39) missense probably benign 0.26
R0730:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0735:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0738:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0786:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0811:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0812:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0881:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0973:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1259:Ptpro UTSW 6 137,369,739 (GRCm39) missense probably damaging 0.98
R1340:Ptpro UTSW 6 137,418,079 (GRCm39) missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1382:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1385:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1396:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1401:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1416:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1422:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1448:Ptpro UTSW 6 137,418,114 (GRCm39) missense probably damaging 1.00
R1513:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1518:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1526:Ptpro UTSW 6 137,438,724 (GRCm39) missense probably damaging 1.00
R1540:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1571:Ptpro UTSW 6 137,355,128 (GRCm39) missense probably benign
R1573:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1587:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1588:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1649:Ptpro UTSW 6 137,421,015 (GRCm39) nonsense probably null
R1700:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1701:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1745:Ptpro UTSW 6 137,377,643 (GRCm39) missense probably benign 0.03
R1772:Ptpro UTSW 6 137,407,741 (GRCm39) missense probably damaging 1.00
R1911:Ptpro UTSW 6 137,377,617 (GRCm39) splice site probably benign
R1958:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1967:Ptpro UTSW 6 137,393,863 (GRCm39) missense probably benign 0.38
R2025:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2026:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2040:Ptpro UTSW 6 137,363,162 (GRCm39) splice site probably benign
R2115:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2117:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2130:Ptpro UTSW 6 137,388,114 (GRCm39) splice site probably null
R2161:Ptpro UTSW 6 137,426,885 (GRCm39) missense probably benign 0.01
R2431:Ptpro UTSW 6 137,420,583 (GRCm39) nonsense probably null
R2915:Ptpro UTSW 6 137,391,239 (GRCm39) start gained probably benign
R2988:Ptpro UTSW 6 137,420,597 (GRCm39) nonsense probably null
R3772:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3773:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3795:Ptpro UTSW 6 137,357,307 (GRCm39) missense probably benign
R3885:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3886:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3887:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3888:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3893:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4032:Ptpro UTSW 6 137,438,740 (GRCm39) missense probably damaging 1.00
R4133:Ptpro UTSW 6 137,397,370 (GRCm39) missense probably damaging 1.00
R4377:Ptpro UTSW 6 137,357,264 (GRCm39) missense probably benign 0.26
R4455:Ptpro UTSW 6 137,370,657 (GRCm39) missense probably damaging 1.00
R4613:Ptpro UTSW 6 137,393,834 (GRCm39) nonsense probably null
R4827:Ptpro UTSW 6 137,419,708 (GRCm39) missense probably damaging 1.00
R4863:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4870:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R4910:Ptpro UTSW 6 137,345,336 (GRCm39) missense probably damaging 0.99
R4932:Ptpro UTSW 6 137,388,103 (GRCm39) nonsense probably null
R4941:Ptpro UTSW 6 137,369,763 (GRCm39) missense probably damaging 1.00
R4989:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5009:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R5032:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5033:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5162:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5393:Ptpro UTSW 6 137,357,222 (GRCm39) missense probably benign 0.04
R5423:Ptpro UTSW 6 137,419,705 (GRCm39) missense probably damaging 1.00
R5782:Ptpro UTSW 6 137,376,496 (GRCm39) missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137,377,704 (GRCm39) missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137,357,606 (GRCm39) missense probably benign 0.28
R6488:Ptpro UTSW 6 137,370,673 (GRCm39) nonsense probably null
R6494:Ptpro UTSW 6 137,359,640 (GRCm39) missense probably benign 0.20
R6746:Ptpro UTSW 6 137,371,821 (GRCm39) missense probably damaging 1.00
R6763:Ptpro UTSW 6 137,395,279 (GRCm39) splice site probably null
R6888:Ptpro UTSW 6 137,357,198 (GRCm39) missense probably benign 0.30
R6983:Ptpro UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
R7019:Ptpro UTSW 6 137,357,476 (GRCm39) missense probably benign
R7218:Ptpro UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
R7299:Ptpro UTSW 6 137,418,142 (GRCm39) critical splice donor site probably null
R7381:Ptpro UTSW 6 137,376,559 (GRCm39) missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137,359,647 (GRCm39) missense probably benign 0.01
R7733:Ptpro UTSW 6 137,391,284 (GRCm39) nonsense probably null
R7793:Ptpro UTSW 6 137,393,818 (GRCm39) missense probably damaging 0.99
R7804:Ptpro UTSW 6 137,376,599 (GRCm39) splice site probably null
R7833:Ptpro UTSW 6 137,393,861 (GRCm39) nonsense probably null
R7859:Ptpro UTSW 6 137,369,805 (GRCm39) critical splice donor site probably null
R7873:Ptpro UTSW 6 137,407,737 (GRCm39) missense probably benign 0.44
R8042:Ptpro UTSW 6 137,393,881 (GRCm39) missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137,403,782 (GRCm39) nonsense probably null
R8979:Ptpro UTSW 6 137,345,140 (GRCm39) missense probably benign
R9138:Ptpro UTSW 6 137,388,113 (GRCm39) critical splice donor site probably null
R9309:Ptpro UTSW 6 137,431,656 (GRCm39) missense probably damaging 1.00
R9420:Ptpro UTSW 6 137,420,933 (GRCm39) missense probably benign 0.08
R9612:Ptpro UTSW 6 137,391,318 (GRCm39) missense probably benign 0.31
R9625:Ptpro UTSW 6 137,371,873 (GRCm39) missense probably damaging 1.00
R9697:Ptpro UTSW 6 137,363,288 (GRCm39) missense probably damaging 1.00
R9715:Ptpro UTSW 6 137,345,108 (GRCm39) missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137,355,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGCATCTGTGTATGTTG -3'
(R):5'- GTTGGAAAAGTATACATGGTCCAGTC -3'

Sequencing Primer
(F):5'- GTGAGGGTAGCTGGCGAATC -3'
(R):5'- GTATACATGGTCCAGTCATAAAACTG -3'
Posted On 2019-06-26