Incidental Mutation 'R0577:Abcc2'
ID56282
Institutional Source Beutler Lab
Gene Symbol Abcc2
Ensembl Gene ENSMUSG00000025194
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 2
Synonymsmultidrug resistance protein 2, Cmoat, Mrp2
MMRRC Submission 038767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0577 (G1)
Quality Score212
Status Validated
Chromosome19
Chromosomal Location43782192-43840740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43819401 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 827 (D827V)
Ref Sequence ENSEMBL: ENSMUSP00000026208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026208]
Predicted Effect probably damaging
Transcript: ENSMUST00000026208
AA Change: D827V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026208
Gene: ENSMUSG00000025194
AA Change: D827V

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 116 N/A INTRINSIC
transmembrane domain 128 150 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:ABC_membrane 319 591 3.4e-37 PFAM
low complexity region 597 608 N/A INTRINSIC
AAA 661 836 1.77e-8 SMART
low complexity region 906 933 N/A INTRINSIC
Pfam:ABC_membrane 977 1249 5.4e-48 PFAM
AAA 1324 1509 1.33e-12 SMART
Meta Mutation Damage Score 0.9471 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the canalicular surface of the hepatocyte and in biliary transport, and appears to contribute to drug resistance in mammalian cells. Several different mutations in the human gene have been observed in patients with Dubin-Johnson syndrome (DJS), an autosomal recessive disorder characterized by conjugated hyperbilirubinemia. Alternative splice variants have been observed for this gene; however, they have not been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have moderately enlarged livers, elevated plasma and urine bilirubin, and a reduced ability to clear various drugs and carcinogens from the blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G T 2: 111,194,349 Q57K probably benign Het
Aars T A 8: 111,043,278 H336Q probably benign Het
Asph G T 4: 9,604,620 A139E probably benign Het
Bag3 T C 7: 128,523,887 M10T probably benign Het
Bod1l T C 5: 41,794,887 D2894G probably damaging Het
Cdk12 T C 11: 98,203,506 S47P probably damaging Het
D1Ertd622e C T 1: 97,661,826 probably null Het
Dchs1 C T 7: 105,764,255 V1118I possibly damaging Het
Ddi2 A T 4: 141,684,507 C365S possibly damaging Het
Eef1g A G 19: 8,973,042 D264G probably benign Het
Fbxw17 T C 13: 50,431,583 L274P probably benign Het
Gpc6 A G 14: 117,436,008 T226A probably benign Het
Klf12 T A 14: 100,023,149 Y48F probably damaging Het
Klhdc4 C T 8: 121,821,351 A67T probably damaging Het
Madd C T 2: 91,138,395 E1596K possibly damaging Het
Mov10l1 A G 15: 89,005,727 Y533C probably damaging Het
Mtif2 G T 11: 29,540,862 probably null Het
Mtmr6 G A 14: 60,296,638 V442I possibly damaging Het
Olfr1504 T C 19: 13,887,803 T136A probably damaging Het
Olfr205 A T 16: 59,328,698 D270E probably benign Het
Olfr725 C T 14: 50,034,792 G204R probably damaging Het
Pdcd11 A G 19: 47,098,832 N277S probably benign Het
Pias2 A T 18: 77,097,281 L12F probably damaging Het
Rnf213 G T 11: 119,443,280 R3105L probably damaging Het
Rps11 A G 7: 45,122,850 V111A probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
Thsd7a T C 6: 12,321,048 T1543A possibly damaging Het
Vmn2r86 C A 10: 130,452,575 R352S probably benign Het
Zfp141 T C 7: 42,476,514 N178S probably benign Het
Zfp955a A T 17: 33,242,094 F355I probably damaging Het
Other mutations in Abcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Abcc2 APN 19 43784202 missense probably benign 0.39
IGL01611:Abcc2 APN 19 43826629 missense probably damaging 1.00
IGL01800:Abcc2 APN 19 43784295 missense possibly damaging 0.78
IGL02008:Abcc2 APN 19 43821750 splice site probably benign
IGL02041:Abcc2 APN 19 43784235 missense probably damaging 1.00
IGL02528:Abcc2 APN 19 43798504 missense probably benign
IGL02950:Abcc2 APN 19 43825967 missense possibly damaging 0.83
IGL03081:Abcc2 APN 19 43782402 utr 5 prime probably benign
IGL03397:Abcc2 APN 19 43784304 missense probably benign 0.00
loser UTSW 19 43839411 utr 3 prime probably benign
nelson UTSW 19 43803739 missense probably benign 0.07
Sore UTSW 19 43798194 missense probably benign 0.22
PIT4453001:Abcc2 UTSW 19 43803782 nonsense probably null
PIT4519001:Abcc2 UTSW 19 43819397 missense possibly damaging 0.81
R0197:Abcc2 UTSW 19 43826614 nonsense probably null
R0326:Abcc2 UTSW 19 43825947 missense possibly damaging 0.90
R0391:Abcc2 UTSW 19 43821605 splice site probably benign
R0558:Abcc2 UTSW 19 43800724 missense probably benign 0.00
R0787:Abcc2 UTSW 19 43798516 critical splice donor site probably null
R1189:Abcc2 UTSW 19 43819413 missense probably damaging 1.00
R1200:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1395:Abcc2 UTSW 19 43833940 missense probably benign 0.22
R1606:Abcc2 UTSW 19 43836652 missense probably damaging 1.00
R1775:Abcc2 UTSW 19 43798419 missense possibly damaging 0.88
R1797:Abcc2 UTSW 19 43814786 missense possibly damaging 0.81
R1797:Abcc2 UTSW 19 43833987 missense probably damaging 0.98
R1826:Abcc2 UTSW 19 43822014 missense probably benign 0.01
R1882:Abcc2 UTSW 19 43798506 missense probably benign 0.00
R1913:Abcc2 UTSW 19 43807244 missense probably benign 0.10
R1986:Abcc2 UTSW 19 43829879 missense probably damaging 1.00
R1991:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R1992:Abcc2 UTSW 19 43807142 missense probably damaging 1.00
R2006:Abcc2 UTSW 19 43805061 missense probably damaging 1.00
R2057:Abcc2 UTSW 19 43818038 missense probably damaging 1.00
R3709:Abcc2 UTSW 19 43798446 missense possibly damaging 0.80
R3802:Abcc2 UTSW 19 43821626 missense probably benign 0.01
R4010:Abcc2 UTSW 19 43829864 missense possibly damaging 0.75
R4014:Abcc2 UTSW 19 43823120 missense probably benign
R4064:Abcc2 UTSW 19 43804993 nonsense probably null
R4296:Abcc2 UTSW 19 43823074 missense probably damaging 1.00
R4296:Abcc2 UTSW 19 43823075 missense probably damaging 1.00
R4363:Abcc2 UTSW 19 43799136 missense possibly damaging 0.94
R4580:Abcc2 UTSW 19 43811119 missense probably damaging 1.00
R4625:Abcc2 UTSW 19 43803739 missense probably benign 0.07
R4631:Abcc2 UTSW 19 43814707 missense possibly damaging 0.70
R4671:Abcc2 UTSW 19 43800718 missense probably benign
R4715:Abcc2 UTSW 19 43816882 missense possibly damaging 0.54
R4726:Abcc2 UTSW 19 43832114 missense probably benign 0.23
R4760:Abcc2 UTSW 19 43810481 missense probably benign 0.03
R4801:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4802:Abcc2 UTSW 19 43819361 missense probably damaging 1.00
R4976:Abcc2 UTSW 19 43800635 missense probably benign 0.34
R5143:Abcc2 UTSW 19 43821661 missense probably benign 0.28
R5206:Abcc2 UTSW 19 43818150 missense probably damaging 1.00
R5376:Abcc2 UTSW 19 43829900 missense possibly damaging 0.76
R5478:Abcc2 UTSW 19 43839465 utr 3 prime probably benign
R5700:Abcc2 UTSW 19 43798194 missense probably benign 0.22
R5863:Abcc2 UTSW 19 43798136 missense probably benign 0.00
R5928:Abcc2 UTSW 19 43819358 missense probably damaging 1.00
R5955:Abcc2 UTSW 19 43813190 missense probably damaging 0.98
R5983:Abcc2 UTSW 19 43819503 missense probably benign
R6014:Abcc2 UTSW 19 43826735 missense probably benign
R6419:Abcc2 UTSW 19 43837508 unclassified probably null
R6497:Abcc2 UTSW 19 43805105 missense probably damaging 1.00
R6510:Abcc2 UTSW 19 43782206 utr 5 prime probably null
R6614:Abcc2 UTSW 19 43819361 missense probably benign 0.01
R6649:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6653:Abcc2 UTSW 19 43812502 missense probably benign 0.05
R6670:Abcc2 UTSW 19 43839411 utr 3 prime probably benign
R6964:Abcc2 UTSW 19 43798076 missense probably benign 0.12
R6989:Abcc2 UTSW 19 43832172 missense probably damaging 1.00
R7015:Abcc2 UTSW 19 43798178 missense probably benign 0.03
R7026:Abcc2 UTSW 19 43816953 missense probably benign 0.00
R7026:Abcc2 UTSW 19 43830535 missense probably benign 0.01
R7136:Abcc2 UTSW 19 43837460 missense probably damaging 1.00
R7252:Abcc2 UTSW 19 43827949 missense probably damaging 0.98
R7293:Abcc2 UTSW 19 43807053 missense probably damaging 1.00
R7392:Abcc2 UTSW 19 43808687 missense probably damaging 0.97
R7450:Abcc2 UTSW 19 43822039 missense probably damaging 1.00
R7654:Abcc2 UTSW 19 43826593 missense possibly damaging 0.87
R7787:Abcc2 UTSW 19 43784246 missense probably damaging 1.00
R7815:Abcc2 UTSW 19 43830427 missense probably benign 0.01
R7911:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R7992:Abcc2 UTSW 19 43803670 missense probably benign 0.00
R8097:Abcc2 UTSW 19 43816955 missense probably benign 0.10
X0025:Abcc2 UTSW 19 43832205 critical splice donor site probably null
Z1177:Abcc2 UTSW 19 43803734 missense probably benign 0.05
Z1177:Abcc2 UTSW 19 43803736 missense probably benign 0.00
Z1177:Abcc2 UTSW 19 43823100 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCAGGATAGGCGCTGGTCTAAGG -3'
(R):5'- TCTGGGCAGTTCAGCTCCAAATG -3'

Sequencing Primer
(F):5'- CTAAGGGATTCTCTCGGGTCAG -3'
(R):5'- TTCACTGGACACTAAATAGCTCAGG -3'
Posted On2013-07-11