Incidental Mutation 'R7236:Senp6'
ID562829
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7236 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80132965 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 785 (V785L)
Ref Sequence ENSEMBL: ENSMUSP00000126777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176527]
Predicted Effect probably damaging
Transcript: ENSMUST00000037484
AA Change: V778L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252
AA Change: V778L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164859
AA Change: V612L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252
AA Change: V612L

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165607
AA Change: V785L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252
AA Change: V785L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect probably benign
Transcript: ENSMUST00000176527
SMART Domains Protein: ENSMUSP00000135719
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
Pfam:Peptidase_C48 114 165 6.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 C T 19: 4,871,616 V179I probably benign Het
Adra1b A G 11: 43,776,324 I362T possibly damaging Het
B3galnt1 T C 3: 69,575,617 K104E probably benign Het
Bnc2 T C 4: 84,555,864 Y15C probably benign Het
C2cd2l C A 9: 44,317,663 A124S possibly damaging Het
Camsap3 T A 8: 3,604,116 F595L probably damaging Het
Cct2 A T 10: 117,061,559 D93E probably benign Het
Cemip A T 7: 83,948,804 probably null Het
Ciapin1 T C 8: 94,823,710 T34A Het
Dopey1 G A 9: 86,515,378 V912I probably damaging Het
Eif3c T C 7: 126,552,323 T610A possibly damaging Het
Ephb3 A G 16: 21,214,481 R106G probably damaging Het
Ephx3 T A 17: 32,185,354 probably null Het
Etv2 A T 7: 30,635,030 S93T probably benign Het
Fbxo34 T A 14: 47,530,384 D451E probably benign Het
Fmo9 A G 1: 166,676,571 F141L probably damaging Het
Fryl T C 5: 73,108,478 K500R possibly damaging Het
Gfra3 T C 18: 34,695,831 D170G probably damaging Het
Gm11639 A T 11: 104,899,267 Q2832L probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm17783 A T 16: 45,527,667 I169N possibly damaging Het
Gm4869 G T 5: 140,471,645 A390S probably benign Het
Gnptg T C 17: 25,239,923 N34S possibly damaging Het
Golga5 T A 12: 102,474,775 probably null Het
Herc2 G T 7: 56,085,080 L139F probably benign Het
Ikzf2 T A 1: 69,539,081 N423I probably benign Het
Il31ra A T 13: 112,523,905 *717R probably null Het
Itga2 G T 13: 114,877,691 Q234K probably benign Het
Kcnt1 A T 2: 25,909,939 probably null Het
Man2a2 T C 7: 80,368,905 S69G probably damaging Het
Mccc1 A G 3: 35,983,795 V294A probably benign Het
Mphosph8 T A 14: 56,674,297 I259K possibly damaging Het
Mrpl15 A T 1: 4,776,488 N288K probably benign Het
Msantd2 T C 9: 37,489,669 W116R probably damaging Het
Mtmr10 T C 7: 64,314,184 probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Nhsl1 A G 10: 18,525,764 K879E probably damaging Het
Olfr1062 A T 2: 86,423,189 C162* probably null Het
Pak6 A G 2: 118,693,428 T355A probably benign Het
Patj C T 4: 98,411,057 R139C probably damaging Het
Pcdhb3 C T 18: 37,301,452 A157V probably damaging Het
Phkg1 C A 5: 129,866,961 D150Y probably damaging Het
Ppp2r5c C T 12: 110,465,889 S45L probably benign Het
Prl4a1 A C 13: 28,018,573 T44P probably benign Het
Ptpro G A 6: 137,368,337 V114M probably damaging Het
Pwp1 A G 10: 85,879,283 N211S probably benign Het
Ralgapb A G 2: 158,440,827 D504G probably benign Het
Rock2 A T 12: 16,929,002 I98F probably damaging Het
Simc1 A G 13: 54,524,796 D319G probably benign Het
Tas2r105 A T 6: 131,686,760 I235N probably damaging Het
Tas2r110 A T 6: 132,868,704 M233L possibly damaging Het
Tmem260 C T 14: 48,509,190 probably null Het
Trank1 G T 9: 111,373,074 V1590L possibly damaging Het
Tsc2 A T 17: 24,623,594 M286K possibly damaging Het
Ttn T C 2: 76,867,452 T202A Het
Ttyh1 A G 7: 4,133,664 N424D probably benign Het
Usp24 T A 4: 106,406,305 probably null Het
Utp20 G T 10: 88,749,342 P2620Q probably benign Het
Vmn1r45 A G 6: 89,933,151 M279T probably benign Het
Vmn2r115 T A 17: 23,359,602 I683K probably benign Het
Vmn2r34 T C 7: 7,681,751 K481E probably damaging Het
Vmn2r54 T A 7: 12,631,990 H339L possibly damaging Het
Vmn2r94 T A 17: 18,257,549 N200I possibly damaging Het
Wdfy3 A G 5: 101,836,208 Y3493H probably damaging Het
Wdr5b A G 16: 36,041,838 D109G possibly damaging Het
Zfp286 A T 11: 62,783,670 probably null Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 splice site probably null
R0308:Senp6 UTSW 9 80132983 critical splice donor site probably null
R0531:Senp6 UTSW 9 80123884 missense probably damaging 0.99
R0743:Senp6 UTSW 9 80093589 missense probably damaging 1.00
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5800:Senp6 UTSW 9 80126433 missense probably damaging 1.00
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5899:Senp6 UTSW 9 80142070 splice site probably benign
R5918:Senp6 UTSW 9 80114116 critical splice donor site probably null
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
R7268:Senp6 UTSW 9 80142124 missense probably damaging 1.00
R7290:Senp6 UTSW 9 80136515 missense probably benign 0.25
R7319:Senp6 UTSW 9 80126199 missense probably damaging 1.00
R7422:Senp6 UTSW 9 80113877 missense probably damaging 1.00
R7474:Senp6 UTSW 9 80142328 missense probably damaging 1.00
R7480:Senp6 UTSW 9 80121917 missense probably damaging 1.00
R7491:Senp6 UTSW 9 80123728 nonsense probably null
R8428:Senp6 UTSW 9 80118512 missense probably damaging 1.00
Z1176:Senp6 UTSW 9 80142266 missense probably benign 0.02
Z1177:Senp6 UTSW 9 80103693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGTTACAGCTGACTCCTC -3'
(R):5'- TCTCCACAGACAATCTTGCATC -3'

Sequencing Primer
(F):5'- ACTCCTCTAATTATAAGTCACTGCCG -3'
(R):5'- GACAATCTTGCATCACACAATCATC -3'
Posted On2019-06-26