Incidental Mutation 'R7236:Pwp1'
ID562833
Institutional Source Beutler Lab
Gene Symbol Pwp1
Ensembl Gene ENSMUSG00000001785
Gene NamePWP1 homolog, endonuclein
Synonyms2610205J09Rik, 2310058A11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7236 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location85829494-85889096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85879283 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 211 (N211S)
Ref Sequence ENSEMBL: ENSMUSP00000001836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000217667] [ENSMUST00000219256]
Predicted Effect probably benign
Transcript: ENSMUST00000001836
AA Change: N211S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785
AA Change: N211S

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Blast:WD40 168 220 4e-27 BLAST
WD40 244 284 4.51e-7 SMART
WD40 287 327 3.37e-6 SMART
WD40 331 370 4.42e1 SMART
WD40 373 413 6.38e-7 SMART
Blast:WD40 418 458 3e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000217667
Predicted Effect probably benign
Transcript: ENSMUST00000219256
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 C T 19: 4,871,616 V179I probably benign Het
Adra1b A G 11: 43,776,324 I362T possibly damaging Het
B3galnt1 T C 3: 69,575,617 K104E probably benign Het
Bnc2 T C 4: 84,555,864 Y15C probably benign Het
C2cd2l C A 9: 44,317,663 A124S possibly damaging Het
Camsap3 T A 8: 3,604,116 F595L probably damaging Het
Cct2 A T 10: 117,061,559 D93E probably benign Het
Cemip A T 7: 83,948,804 probably null Het
Ciapin1 T C 8: 94,823,710 T34A Het
Dopey1 G A 9: 86,515,378 V912I probably damaging Het
Eif3c T C 7: 126,552,323 T610A possibly damaging Het
Ephb3 A G 16: 21,214,481 R106G probably damaging Het
Ephx3 T A 17: 32,185,354 probably null Het
Etv2 A T 7: 30,635,030 S93T probably benign Het
Fbxo34 T A 14: 47,530,384 D451E probably benign Het
Fmo9 A G 1: 166,676,571 F141L probably damaging Het
Fryl T C 5: 73,108,478 K500R possibly damaging Het
Gfra3 T C 18: 34,695,831 D170G probably damaging Het
Gm11639 A T 11: 104,899,267 Q2832L probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm17783 A T 16: 45,527,667 I169N possibly damaging Het
Gm4869 G T 5: 140,471,645 A390S probably benign Het
Gnptg T C 17: 25,239,923 N34S possibly damaging Het
Golga5 T A 12: 102,474,775 probably null Het
Herc2 G T 7: 56,085,080 L139F probably benign Het
Ikzf2 T A 1: 69,539,081 N423I probably benign Het
Il31ra A T 13: 112,523,905 *717R probably null Het
Itga2 G T 13: 114,877,691 Q234K probably benign Het
Kcnt1 A T 2: 25,909,939 probably null Het
Man2a2 T C 7: 80,368,905 S69G probably damaging Het
Mccc1 A G 3: 35,983,795 V294A probably benign Het
Mphosph8 T A 14: 56,674,297 I259K possibly damaging Het
Mrpl15 A T 1: 4,776,488 N288K probably benign Het
Msantd2 T C 9: 37,489,669 W116R probably damaging Het
Mtmr10 T C 7: 64,314,184 probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Nhsl1 A G 10: 18,525,764 K879E probably damaging Het
Olfr1062 A T 2: 86,423,189 C162* probably null Het
Pak6 A G 2: 118,693,428 T355A probably benign Het
Patj C T 4: 98,411,057 R139C probably damaging Het
Pcdhb3 C T 18: 37,301,452 A157V probably damaging Het
Phkg1 C A 5: 129,866,961 D150Y probably damaging Het
Ppp2r5c C T 12: 110,465,889 S45L probably benign Het
Prl4a1 A C 13: 28,018,573 T44P probably benign Het
Ptpro G A 6: 137,368,337 V114M probably damaging Het
Ralgapb A G 2: 158,440,827 D504G probably benign Het
Rock2 A T 12: 16,929,002 I98F probably damaging Het
Senp6 G T 9: 80,132,965 V785L probably damaging Het
Simc1 A G 13: 54,524,796 D319G probably benign Het
Tas2r105 A T 6: 131,686,760 I235N probably damaging Het
Tas2r110 A T 6: 132,868,704 M233L possibly damaging Het
Tmem260 C T 14: 48,509,190 probably null Het
Trank1 G T 9: 111,373,074 V1590L possibly damaging Het
Tsc2 A T 17: 24,623,594 M286K possibly damaging Het
Ttn T C 2: 76,867,452 T202A Het
Ttyh1 A G 7: 4,133,664 N424D probably benign Het
Usp24 T A 4: 106,406,305 probably null Het
Utp20 G T 10: 88,749,342 P2620Q probably benign Het
Vmn1r45 A G 6: 89,933,151 M279T probably benign Het
Vmn2r115 T A 17: 23,359,602 I683K probably benign Het
Vmn2r34 T C 7: 7,681,751 K481E probably damaging Het
Vmn2r54 T A 7: 12,631,990 H339L possibly damaging Het
Vmn2r94 T A 17: 18,257,549 N200I possibly damaging Het
Wdfy3 A G 5: 101,836,208 Y3493H probably damaging Het
Wdr5b A G 16: 36,041,838 D109G possibly damaging Het
Zfp286 A T 11: 62,783,670 probably null Het
Other mutations in Pwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Pwp1 APN 10 85878516 missense probably damaging 1.00
IGL00778:Pwp1 APN 10 85879888 missense probably benign 0.05
IGL01086:Pwp1 APN 10 85879893 splice site probably null
IGL02526:Pwp1 APN 10 85882103 splice site probably null
IGL02596:Pwp1 APN 10 85872018 splice site probably null
IGL03164:Pwp1 APN 10 85878503 missense probably benign 0.19
IGL03269:Pwp1 APN 10 85882904 missense probably damaging 0.98
Annuals UTSW 10 85876514 missense probably damaging 1.00
R0031:Pwp1 UTSW 10 85885896 missense probably benign 0.20
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0766:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R0926:Pwp1 UTSW 10 85876514 missense probably damaging 1.00
R1238:Pwp1 UTSW 10 85885862 missense probably benign 0.02
R1312:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R1420:Pwp1 UTSW 10 85876538 missense probably damaging 1.00
R3177:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3277:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3818:Pwp1 UTSW 10 85888129 missense possibly damaging 0.76
R4008:Pwp1 UTSW 10 85882034 missense possibly damaging 0.60
R5964:Pwp1 UTSW 10 85882886 missense probably damaging 1.00
R6252:Pwp1 UTSW 10 85874509 missense probably benign 0.00
R6280:Pwp1 UTSW 10 85874462 missense probably damaging 0.99
R6765:Pwp1 UTSW 10 85884533 missense probably damaging 0.99
R7168:Pwp1 UTSW 10 85884537 missense probably damaging 1.00
R7213:Pwp1 UTSW 10 85876309 missense probably benign
R7840:Pwp1 UTSW 10 85888050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTCAAGCTCAGGGGTG -3'
(R):5'- CCTGTTCCACCAAAACTATCTGATTG -3'

Sequencing Primer
(F):5'- GGCATGGGAACTGTTAGGCC -3'
(R):5'- CTATCTGATTGCAACAATACAAGTTC -3'
Posted On2019-06-26