Incidental Mutation 'R7236:Ppp2r5c'
ID562841
Institutional Source Beutler Lab
Gene Symbol Ppp2r5c
Ensembl Gene ENSMUSG00000017843
Gene Nameprotein phosphatase 2, regulatory subunit B', gamma
Synonyms2700063L20Rik, 2610043M05Rik, Band 8A, D12Bwg0916e, B56/PP2A gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7236 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110447120-110583062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110465889 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 45 (S45L)
Ref Sequence ENSEMBL: ENSMUSP00000152095 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000220509
AA Change: S45L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele show partial neonatal lethality, hypoactivity, and abnormal ventricular septum formation associated with increased fetal cardiomyocyte apoptosis. Surviving homozygotes develop obesity and show an abnormal gait, decreased grip strength, and impaired balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 C T 19: 4,871,616 V179I probably benign Het
Adra1b A G 11: 43,776,324 I362T possibly damaging Het
B3galnt1 T C 3: 69,575,617 K104E probably benign Het
Bnc2 T C 4: 84,555,864 Y15C probably benign Het
C2cd2l C A 9: 44,317,663 A124S possibly damaging Het
Camsap3 T A 8: 3,604,116 F595L probably damaging Het
Cct2 A T 10: 117,061,559 D93E probably benign Het
Cemip A T 7: 83,948,804 probably null Het
Ciapin1 T C 8: 94,823,710 T34A Het
Dopey1 G A 9: 86,515,378 V912I probably damaging Het
Eif3c T C 7: 126,552,323 T610A possibly damaging Het
Ephb3 A G 16: 21,214,481 R106G probably damaging Het
Ephx3 T A 17: 32,185,354 probably null Het
Etv2 A T 7: 30,635,030 S93T probably benign Het
Fbxo34 T A 14: 47,530,384 D451E probably benign Het
Fmo9 A G 1: 166,676,571 F141L probably damaging Het
Fryl T C 5: 73,108,478 K500R possibly damaging Het
Gfra3 T C 18: 34,695,831 D170G probably damaging Het
Gm11639 A T 11: 104,899,267 Q2832L probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm17783 A T 16: 45,527,667 I169N possibly damaging Het
Gm4869 G T 5: 140,471,645 A390S probably benign Het
Gnptg T C 17: 25,239,923 N34S possibly damaging Het
Golga5 T A 12: 102,474,775 probably null Het
Herc2 G T 7: 56,085,080 L139F probably benign Het
Ikzf2 T A 1: 69,539,081 N423I probably benign Het
Il31ra A T 13: 112,523,905 *717R probably null Het
Itga2 G T 13: 114,877,691 Q234K probably benign Het
Kcnt1 A T 2: 25,909,939 probably null Het
Man2a2 T C 7: 80,368,905 S69G probably damaging Het
Mccc1 A G 3: 35,983,795 V294A probably benign Het
Mphosph8 T A 14: 56,674,297 I259K possibly damaging Het
Mrpl15 A T 1: 4,776,488 N288K probably benign Het
Msantd2 T C 9: 37,489,669 W116R probably damaging Het
Mtmr10 T C 7: 64,314,184 probably benign Het
Mylk A T 16: 34,922,529 D1137V probably damaging Het
Nhsl1 A G 10: 18,525,764 K879E probably damaging Het
Olfr1062 A T 2: 86,423,189 C162* probably null Het
Pak6 A G 2: 118,693,428 T355A probably benign Het
Patj C T 4: 98,411,057 R139C probably damaging Het
Pcdhb3 C T 18: 37,301,452 A157V probably damaging Het
Phkg1 C A 5: 129,866,961 D150Y probably damaging Het
Prl4a1 A C 13: 28,018,573 T44P probably benign Het
Ptpro G A 6: 137,368,337 V114M probably damaging Het
Pwp1 A G 10: 85,879,283 N211S probably benign Het
Ralgapb A G 2: 158,440,827 D504G probably benign Het
Rock2 A T 12: 16,929,002 I98F probably damaging Het
Senp6 G T 9: 80,132,965 V785L probably damaging Het
Simc1 A G 13: 54,524,796 D319G probably benign Het
Tas2r105 A T 6: 131,686,760 I235N probably damaging Het
Tas2r110 A T 6: 132,868,704 M233L possibly damaging Het
Tmem260 C T 14: 48,509,190 probably null Het
Trank1 G T 9: 111,373,074 V1590L possibly damaging Het
Tsc2 A T 17: 24,623,594 M286K possibly damaging Het
Ttn T C 2: 76,867,452 T202A Het
Ttyh1 A G 7: 4,133,664 N424D probably benign Het
Usp24 T A 4: 106,406,305 probably null Het
Utp20 G T 10: 88,749,342 P2620Q probably benign Het
Vmn1r45 A G 6: 89,933,151 M279T probably benign Het
Vmn2r115 T A 17: 23,359,602 I683K probably benign Het
Vmn2r34 T C 7: 7,681,751 K481E probably damaging Het
Vmn2r54 T A 7: 12,631,990 H339L possibly damaging Het
Vmn2r94 T A 17: 18,257,549 N200I possibly damaging Het
Wdfy3 A G 5: 101,836,208 Y3493H probably damaging Het
Wdr5b A G 16: 36,041,838 D109G possibly damaging Het
Zfp286 A T 11: 62,783,670 probably null Het
Other mutations in Ppp2r5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ppp2r5c APN 12 110567827 missense probably benign 0.09
IGL01743:Ppp2r5c APN 12 110580434 missense probably benign 0.00
IGL01866:Ppp2r5c APN 12 110567827 missense probably benign 0.24
IGL02883:Ppp2r5c APN 12 110522563 missense possibly damaging 0.48
IGL02944:Ppp2r5c APN 12 110567800 missense probably benign 0.02
Abscond UTSW 12 110544077 missense probably benign 0.02
Cranraisin UTSW 12 110544145 missense probably damaging 1.00
elope UTSW 12 110561472 splice site probably benign
FR4976:Ppp2r5c UTSW 12 110540738 splice site probably null
R0020:Ppp2r5c UTSW 12 110574823 nonsense probably null
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0456:Ppp2r5c UTSW 12 110522579 missense probably damaging 0.99
R1521:Ppp2r5c UTSW 12 110554886 missense probably damaging 1.00
R1697:Ppp2r5c UTSW 12 110545623 nonsense probably null
R1697:Ppp2r5c UTSW 12 110561472 splice site probably benign
R2248:Ppp2r5c UTSW 12 110485923 missense probably benign 0.00
R3817:Ppp2r5c UTSW 12 110544187 critical splice donor site probably null
R4491:Ppp2r5c UTSW 12 110580522 missense possibly damaging 0.69
R5575:Ppp2r5c UTSW 12 110552832 missense probably damaging 1.00
R5828:Ppp2r5c UTSW 12 110570700 missense probably benign 0.01
R6059:Ppp2r5c UTSW 12 110574788 missense probably benign
R6351:Ppp2r5c UTSW 12 110554879 missense probably damaging 1.00
R6807:Ppp2r5c UTSW 12 110569022 missense possibly damaging 0.80
R6976:Ppp2r5c UTSW 12 110544145 missense probably damaging 1.00
R7360:Ppp2r5c UTSW 12 110574838 missense probably benign
R7363:Ppp2r5c UTSW 12 110522607 missense probably benign 0.01
R7467:Ppp2r5c UTSW 12 110552883 missense probably damaging 1.00
R7948:Ppp2r5c UTSW 12 110465986 missense probably benign
R8117:Ppp2r5c UTSW 12 110551085 missense possibly damaging 0.47
R8310:Ppp2r5c UTSW 12 110545825 missense possibly damaging 0.95
R8352:Ppp2r5c UTSW 12 110544077 missense probably benign 0.02
R8452:Ppp2r5c UTSW 12 110544077 missense probably benign 0.02
R8692:Ppp2r5c UTSW 12 110522598 missense probably benign 0.00
R8858:Ppp2r5c UTSW 12 110552895 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGAAGAACACTGCCCCAG -3'
(R):5'- GTTAGCGCAGTAAAGCAAGC -3'

Sequencing Primer
(F):5'- CCCAGAGGAGCAGTGTGTGTG -3'
(R):5'- ACCAGAAACCGAATCAGGAG -3'
Posted On2019-06-26