Mutagenetix > Incidental Mutations

Incidental Mutation 'R7237:Card9'

562871

Institutional Source

Beutler Lab

Gene Symbol

Card9

Ensembl Gene

ENSMUSG00000026928

Gene Name

caspase recruitment domain family, member 9

Synonyms

LOC332579

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001037747; MGI:2685628

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7237 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26352176-26360918 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26356775 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 354 (S354T)

Ref Sequence

ENSEMBL: ENSMUSP00000097876 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028294] [ENSMUST00000028295] [ENSMUST00000100303]

Predicted Effect

probably benign
Transcript: ENSMUST00000028294
AA Change: S354T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000028294
Gene: ENSMUSG00000026928
AA Change: S354T

Domain	Start	End	E-Value	Type
Pfam:CARD	11	97	3.1e-21	PFAM
coiled coil region	145	272	N/A	INTRINSIC
coiled coil region	375	415	N/A	INTRINSIC
low complexity region	482	494	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000028295

SMART Domains

Protein: ENSMUSP00000028295
Gene: ENSMUSG00000075467

Domain	Start	End	E-Value	Type
low complexity region	38	67	N/A	INTRINSIC
Pfam:zf-DNL	74	139	4.1e-34	PFAM
low complexity region	158	172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100303
AA Change: S354T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000097876
Gene: ENSMUSG00000026928
AA Change: S354T

Domain	Start	End	E-Value	Type
Pfam:CARD	11	97	7.1e-22	PFAM
coiled coil region	145	272	N/A	INTRINSIC
coiled coil region	375	415	N/A	INTRINSIC
low complexity region	482	494	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

98% (83/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele of this gene display impaired immune responses to fungal infection but normal rates of bacterial clearance. However, homozygotes for a second allele display impaired bacterial clearance and impaired early innate immune responses. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap21	A	T	2: 20,849,972	C1536*	probably null	Het
Armc9	C	A	1: 86,164,849	Q169K	possibly damaging	Het
Aspm	T	A	1: 139,477,929	M1518K	possibly damaging	Het
AU018091	A	G	7: 3,159,166	I360T	probably benign	Het
BB014433	C	A	8: 15,041,765	V363L	probably benign	Het
Bcam	T	C	7: 19,769,307		probably null	Het
Cacna1g	T	C	11: 94,437,879	S1071G	probably benign	Het
Ccdc87	A	G	19: 4,839,762	N94S	probably benign	Het
Cdc27	A	G	11: 104,517,419	V555A	probably benign	Het
Coro1a	T	A	7: 126,700,306	D411V	probably benign	Het
Cybrd1	GGTCCTGCAC	G	2: 71,118,209		probably benign	Het
Cyth1	A	T	11: 118,185,495	I95N	probably damaging	Het
Ddx58	T	A	4: 40,205,938	I885F	probably benign	Het
Dnah7b	A	T	1: 46,139,966	E933V	probably damaging	Het
Dync2h1	A	T	9: 6,993,966	I3968N	probably benign	Het
Fam126b	G	A	1: 58,529,948	Q491*	probably null	Het
Fam184a	T	C	10: 53,634,393		probably benign	Het
Fat3	G	A	9: 16,377,214	L338F	probably damaging	Het
Fcgr3	A	G	1: 171,059,301	L18P	probably damaging	Het
Gbp5	T	C	3: 142,507,700	V459A	probably benign	Het
Gja4	A	T	4: 127,312,163	M269K	probably benign	Het
Gm4787	A	G	12: 81,377,668	V572A	probably damaging	Het
Grin2d	G	T	7: 45,866,176	S131*	probably null	Het
Gys1	A	G	7: 45,455,162	D671G	probably benign	Het
Haspin	T	C	11: 73,136,886	N459S	probably benign	Het
Hdac10	G	T	15: 89,125,377	Q451K	probably benign	Het
Hdac9	T	C	12: 34,374,140		probably null	Het
Hmcn1	A	G	1: 150,722,643	V1636A	probably damaging	Het
Hpca	A	G	4: 129,118,614	L43P	probably damaging	Het
Insm1	C	A	2: 146,222,528	A88E	possibly damaging	Het
Itga9	A	G	9: 118,636,602	K175E	probably benign	Het
Kif13a	A	G	13: 46,809,156		probably null	Het
Kif20b	T	A	19: 34,950,605	L1089H	probably damaging	Het
Lamp5	A	T	2: 136,059,835	H152L	probably benign	Het
Lrp4	T	C	2: 91,473,183	F76L	probably benign	Het
Magi3	T	C	3: 104,027,911	D902G	probably damaging	Het
Map10	C	T	8: 125,671,224	P452L	probably benign	Het
Mapk6	A	G	9: 75,397,613	L174P	probably damaging	Het
Ndufa4	C	T	6: 11,906,019		probably null	Het
Nedd4	A	T	9: 72,725,064	E393D	probably benign	Het
Nlrp4b	G	A	7: 10,715,216	V449I	probably benign	Het
Nufip2	T	A	11: 77,692,770	N503K	probably benign	Het
Olfr220	C	T	1: 174,449,339	R239C	probably benign	Het
Olfr455	T	C	6: 42,538,647	D125G	probably damaging	Het
P4ha1	A	G	10: 59,348,243	T176A	probably benign	Het
Palm3	A	G	8: 84,029,488	K543R	probably benign	Het
Parvg	G	A	15: 84,341,356	A302T	probably benign	Het
Pcdh15	A	G	10: 74,584,191	D1227G	possibly damaging	Het
Pdzd8	C	T	19: 59,345,139	G150D	probably damaging	Het
Pitpnm2	A	G	5: 124,125,297		probably null	Het
Pld5	T	C	1: 176,274,735	Q47R	possibly damaging	Het
Ppp2r5d	T	C	17: 46,686,280	S329G	possibly damaging	Het
Prss56	T	C	1: 87,184,915	V144A	probably damaging	Het
Psg28	A	T	7: 18,427,844	Y245N	possibly damaging	Het
Ptpn3	C	T	4: 57,239,625	V302I	probably damaging	Het
Ptprn2	A	G	12: 117,161,727	H627R	probably benign	Het
Rasgrp2	A	T	19: 6,404,808	H226L	possibly damaging	Het
Rbm20	C	T	19: 53,851,499	T973M	probably benign	Het
Riok2	T	A	17: 17,377,783	L44Q	probably damaging	Het
Rusc1	G	T	3: 89,091,498	Q326K	possibly damaging	Het
Sart3	A	T	5: 113,754,246	H397Q	possibly damaging	Het
Sec31b	T	A	19: 44,517,708	T920S	probably damaging	Het
Serpinb13	A	G	1: 106,998,949	E225G	probably damaging	Het
Slc25a47	T	C	12: 108,855,460	L165P	probably damaging	Het
Slc2a10	G	A	2: 165,515,277	V286I	probably benign	Het
Slc39a13	G	T	2: 91,065,634	T174N	probably benign	Het
Slc7a13	T	A	4: 19,839,364	N322K	probably benign	Het
Stk38	T	C	17: 28,974,646	T326A	possibly damaging	Het
Sult1a1	T	C	7: 126,673,450	M244V	probably benign	Het
Tas2r144	C	T	6: 42,215,866	T180I	probably damaging	Het
Tbc1d12	T	A	19: 38,898,902	M366K	probably benign	Het
Terb1	T	C	8: 104,495,327	I147V	possibly damaging	Het
Tldc1	C	T	8: 119,762,315	G410S	probably damaging	Het
Tmem5	A	T	10: 122,081,618	L330*	probably null	Het
Tnik	T	C	3: 28,638,419	Y820H	probably damaging	Het
Tnxb	C	A	17: 34,682,196	L995I	possibly damaging	Het
Trim34b	A	G	7: 104,329,587	T14A	possibly damaging	Het
Urb1	T	C	16: 90,791,166	E418G	probably damaging	Het
Vmn1r12	T	A	6: 57,159,565	C216S	possibly damaging	Het
Vmn2r90	T	A	17: 17,703,987	V16E	possibly damaging	Het
Vps11	A	T	9: 44,354,506	V492D	probably damaging	Het
Wdr62	A	C	7: 30,270,444		probably null	Het
Zc3h14	T	A	12: 98,780,149	M539K	probably benign	Het
Zfp871	A	T	17: 32,775,315	H295Q	probably damaging	Het

Other mutations in Card9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01704:Card9	APN	2	26356862	missense	probably benign
IGL02397:Card9	APN	2	26352329	missense	probably damaging	1.00
IGL02506:Card9	APN	2	26354415	splice site	probably benign
IGL02536:Card9	APN	2	26358832	missense	possibly damaging	0.93
IGL02809:Card9	APN	2	26356864	missense	probably benign	0.01
IGL02962:Card9	APN	2	26358017	critical splice acceptor site	probably null
R1441:Card9	UTSW	2	26359390	missense	probably benign	0.01
R1585:Card9	UTSW	2	26354386	missense	probably benign	0.01
R1755:Card9	UTSW	2	26359534	missense	probably damaging	0.99
R1959:Card9	UTSW	2	26354873	critical splice acceptor site	probably null
R2972:Card9	UTSW	2	26357210	missense	probably damaging	1.00
R4007:Card9	UTSW	2	26353000	missense	possibly damaging	0.95
R4283:Card9	UTSW	2	26357297	missense	possibly damaging	0.77
R4789:Card9	UTSW	2	26357620	missense	probably damaging	0.99
R5381:Card9	UTSW	2	26358883	missense	probably damaging	1.00
R5933:Card9	UTSW	2	26352497	missense	probably damaging	1.00
R6379:Card9	UTSW	2	26356777	missense	probably damaging	1.00
R7008:Card9	UTSW	2	26357799	missense	possibly damaging	0.96
R7124:Card9	UTSW	2	26356884	critical splice acceptor site	probably null
R7131:Card9	UTSW	2	26358835	missense	probably damaging	1.00
R7171:Card9	UTSW	2	26359484	missense	possibly damaging	0.78
R7984:Card9	UTSW	2	26356772	missense	probably benign	0.00
R8023:Card9	UTSW	2	26357315	missense	probably benign	0.00
R8312:Card9	UTSW	2	26357789	nonsense	probably null
R8672:Card9	UTSW	2	26357938	missense	probably benign	0.30
Z1176:Card9	UTSW	2	26357796	missense	probably damaging	1.00
Z1177:Card9	UTSW	2	26357551	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGATGCATTTGTACAAGCAGTCC -3'
(R):5'- ATTATCCCAGACCTTGTGTGC -3'

Sequencing Primer
(F):5'- TTGTACAAGCAGTCCCGGGTTC -3'
(R):5'- AGACCTTGTGTGCCCTGGAG -3'

Posted On

2019-06-26