Incidental Mutation 'R0578:Rxra'
ID56288
Institutional Source Beutler Lab
Gene Symbol Rxra
Ensembl Gene ENSMUSG00000015846
Gene Nameretinoid X receptor alpha
SynonymsRXRalpha1, RXR alpha 1, 9530071D11Rik
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0578 (G1)
Quality Score168
Status Validated
Chromosome2
Chromosomal Location27676440-27762957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27759570 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 429 (A429V)
Ref Sequence ENSEMBL: ENSMUSP00000133044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077257] [ENSMUST00000100251] [ENSMUST00000113934] [ENSMUST00000166775]
PDB Structure
CRYSTAL STRUCTURE OF A HETERODIMERIC COMPLEX OF RAR AND RXR LIGAND-BINDING DOMAINS [X-RAY DIFFRACTION]
Crystal Structure of the RARbeta/RXRalpha Ligand Binding Domain Heterodimer in Complex with 9-cis Retinoic Acid and a Fragment of the TRAP220 Coactivator [X-RAY DIFFRACTION]
Crystal structure of a mixed agonist-bound RAR-alpha and antagonist-bound RXR-alpha heterodimer ligand binding domains [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000077257
AA Change: A429V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076491
Gene: ENSMUSG00000015846
AA Change: A429V

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 18 132 4.2e-42 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100251
AA Change: A401V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097822
Gene: ENSMUSG00000015846
AA Change: A401V

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113934
AA Change: A401V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109567
Gene: ENSMUSG00000015846
AA Change: A401V

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 1 104 1.8e-38 PFAM
ZnF_C4 109 180 1.76e-40 SMART
Blast:HOLI 205 237 1e-8 BLAST
HOLI 247 406 1.62e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166775
AA Change: A429V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133044
Gene: ENSMUSG00000015846
AA Change: A429V

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 17 132 6.5e-41 PFAM
ZnF_C4 137 208 1.76e-40 SMART
Blast:HOLI 233 265 1e-8 BLAST
HOLI 275 434 1.62e-53 SMART
Meta Mutation Damage Score 0.4020 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Rxra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Rxra APN 2 27754241 missense probably damaging 1.00
IGL03006:Rxra APN 2 27759645 missense probably damaging 1.00
pinkie UTSW 2 27752334 missense probably damaging 0.98
R0265:Rxra UTSW 2 27752430 missense probably damaging 1.00
R1555:Rxra UTSW 2 27748678 missense probably benign 0.00
R1775:Rxra UTSW 2 27756244 missense probably damaging 1.00
R3725:Rxra UTSW 2 27754277 missense probably damaging 1.00
R3756:Rxra UTSW 2 27741911 missense probably damaging 1.00
R3804:Rxra UTSW 2 27756260 missense probably damaging 1.00
R3965:Rxra UTSW 2 27752306 splice site probably benign
R4490:Rxra UTSW 2 27741195 missense probably damaging 0.99
R4898:Rxra UTSW 2 27741183 missense probably damaging 1.00
R5154:Rxra UTSW 2 27757868 critical splice donor site probably null
R5651:Rxra UTSW 2 27737341 missense probably benign 0.25
R6880:Rxra UTSW 2 27748656 missense possibly damaging 0.64
R6913:Rxra UTSW 2 27741174 missense probably damaging 1.00
R7404:Rxra UTSW 2 27741854 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCCTGGAGCATCAGTTTAGGCAG -3'
(R):5'- GGTGACAGCAGCATAGCCTTAGAG -3'

Sequencing Primer
(F):5'- AGCATCAGTTTAGGCAGTTTCC -3'
(R):5'- CATAGCCTTAGAGCCTGATGTAG -3'
Posted On2013-07-11