Incidental Mutation 'R0578:Olfr994'
ID56289
Institutional Source Beutler Lab
Gene Symbol Olfr994
Ensembl Gene ENSMUSG00000075219
Gene Nameolfactory receptor 994
SynonymsMOR203-4, GA_x6K02T2Q125-46907515-46906571
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0578 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85429380-85436451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85430673 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000149417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099925] [ENSMUST00000214679] [ENSMUST00000217218]
Predicted Effect probably benign
Transcript: ENSMUST00000099925
AA Change: D52G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097509
Gene: ENSMUSG00000075219
AA Change: D52G

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 302 3.5e-5 PFAM
Pfam:7tm_1 41 289 8.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214679
AA Change: D52G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215758
Predicted Effect probably benign
Transcript: ENSMUST00000217218
AA Change: D52G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Olfr994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr994 APN 2 85430140 missense probably benign 0.00
IGL01325:Olfr994 APN 2 85430295 missense possibly damaging 0.60
IGL01634:Olfr994 APN 2 85430439 missense probably damaging 1.00
IGL01809:Olfr994 APN 2 85430154 missense probably damaging 1.00
IGL02586:Olfr994 APN 2 85430466 missense possibly damaging 0.80
IGL02711:Olfr994 APN 2 85430739 missense probably damaging 0.97
R0010:Olfr994 UTSW 2 85429895 missense probably benign
R0848:Olfr994 UTSW 2 85430021 missense probably benign 0.03
R1844:Olfr994 UTSW 2 85429921 missense probably benign 0.03
R1912:Olfr994 UTSW 2 85430260 missense probably damaging 0.97
R1959:Olfr994 UTSW 2 85430619 missense probably damaging 1.00
R2014:Olfr994 UTSW 2 85430352 missense possibly damaging 0.89
R2113:Olfr994 UTSW 2 85430086 missense probably damaging 1.00
R2290:Olfr994 UTSW 2 85430200 missense possibly damaging 0.64
R3622:Olfr994 UTSW 2 85430493 missense probably benign 0.12
R3918:Olfr994 UTSW 2 85430730 missense possibly damaging 0.64
R4175:Olfr994 UTSW 2 85430618 missense probably damaging 1.00
R4945:Olfr994 UTSW 2 85430551 missense probably benign 0.03
R6132:Olfr994 UTSW 2 85430146 missense probably benign 0.06
R6439:Olfr994 UTSW 2 85430724 missense probably damaging 1.00
R6713:Olfr994 UTSW 2 85430539 missense probably damaging 1.00
R7065:Olfr994 UTSW 2 85430179 missense probably damaging 1.00
R7089:Olfr994 UTSW 2 85430558 missense probably benign 0.00
R7467:Olfr994 UTSW 2 85430827 start codon destroyed possibly damaging 0.90
R8006:Olfr994 UTSW 2 85429974 missense probably damaging 1.00
R8021:Olfr994 UTSW 2 85430652 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTATGGGGTAGCGAAGGGGCTTAC -3'
(R):5'- CACAAGGCAATGGCACTGAAGTCAC -3'

Sequencing Primer
(F):5'- GGGCTTACAGATTGCCACATAC -3'
(R):5'- AAGTCACTGACTTCTATCTTCTGG -3'
Posted On2013-07-11