Incidental Mutation 'R7237:Vps11'
List |< first << previous [record 82 of 85] next >> last >|
ID562907
Institutional Source Beutler Lab
Gene Symbol Vps11
Ensembl Gene ENSMUSG00000032127
Gene NameVPS11, CORVET/HOPS core subunit
Synonyms1200011A11Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_027889.1; MGI:1918982

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7237 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44347749-44361670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44354506 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 492 (V492D)
Ref Sequence ENSEMBL: ENSMUSP00000034644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034644] [ENSMUST00000213249] [ENSMUST00000213740] [ENSMUST00000214510]
Predicted Effect probably damaging
Transcript: ENSMUST00000034644
AA Change: V492D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034644
Gene: ENSMUSG00000032127
AA Change: V492D

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
SCOP:d1erja_ 59 292 3e-10 SMART
Blast:WD40 73 117 2e-22 BLAST
Blast:WD40 125 168 9e-24 BLAST
Blast:WD40 175 214 6e-16 BLAST
Blast:WD40 219 259 2e-20 BLAST
Pfam:Clathrin 412 548 2.7e-16 PFAM
coiled coil region 775 813 N/A INTRINSIC
RING 822 860 6.14e-5 SMART
Pfam:VPS11_C 862 908 5.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213249
Predicted Effect probably benign
Transcript: ENSMUST00000213740
Predicted Effect probably benign
Transcript: ENSMUST00000214460
Predicted Effect probably benign
Transcript: ENSMUST00000214510
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps11 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Bcam T C 7: 19,769,307 probably null Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fam184a T C 10: 53,634,393 probably benign Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Fcgr3 A G 1: 171,059,301 L18P probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Grin2d G T 7: 45,866,176 S131* probably null Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hdac9 T C 12: 34,374,140 probably null Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Itga9 A G 9: 118,636,602 K175E probably benign Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Ppp2r5d T C 17: 46,686,280 S329G possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnxb C A 17: 34,682,196 L995I possibly damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Wdr62 A C 7: 30,270,444 probably null Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Vps11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Vps11 APN 9 44356219 splice site probably benign
IGL03135:Vps11 APN 9 44356356 missense probably benign 0.39
PIT4696001:Vps11 UTSW 9 44358189 missense possibly damaging 0.89
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0042:Vps11 UTSW 9 44356291 nonsense probably null
R0122:Vps11 UTSW 9 44354512 missense probably damaging 1.00
R0335:Vps11 UTSW 9 44353838 missense probably null 0.02
R0714:Vps11 UTSW 9 44359656 missense possibly damaging 0.90
R1068:Vps11 UTSW 9 44353019 missense probably damaging 1.00
R1873:Vps11 UTSW 9 44359936 missense probably damaging 1.00
R1991:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2068:Vps11 UTSW 9 44358316 missense probably damaging 0.99
R2084:Vps11 UTSW 9 44353261 missense probably benign 0.14
R2103:Vps11 UTSW 9 44359227 missense probably damaging 0.97
R2119:Vps11 UTSW 9 44348997 missense probably benign 0.01
R4160:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4161:Vps11 UTSW 9 44355720 missense probably damaging 0.98
R4564:Vps11 UTSW 9 44361597 missense probably damaging 1.00
R4879:Vps11 UTSW 9 44353300 missense probably benign
R5629:Vps11 UTSW 9 44356376 missense probably damaging 1.00
R5910:Vps11 UTSW 9 44359135 splice site probably null
R5988:Vps11 UTSW 9 44353924 missense probably benign 0.01
R6430:Vps11 UTSW 9 44361550 missense probably benign 0.11
R7002:Vps11 UTSW 9 44355079 missense probably damaging 1.00
R7147:Vps11 UTSW 9 44355082 nonsense probably null
R7261:Vps11 UTSW 9 44354503 missense probably damaging 1.00
R7577:Vps11 UTSW 9 44348961 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAAGGGCTTCCTGATAGTTCTG -3'
(R):5'- GCAAAAGGCTGGTTGGCATG -3'

Sequencing Primer
(F):5'- TGAAGAAGTGCCCCGGTC -3'
(R):5'- GTTTTTCAAGCCAGGATGTAATTGCC -3'
Posted On2019-06-26