Incidental Mutation 'R7237:Itga9'
ID562910
Institutional Source Beutler Lab
Gene Symbol Itga9
Ensembl Gene ENSMUSG00000039115
Gene Nameintegrin alpha 9
SynonymsD9Ertd428e, 2610002H11Rik, 6720458D17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7237 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location118606690-118901003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118636602 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 175 (K175E)
Ref Sequence ENSEMBL: ENSMUSP00000044227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044165]
Predicted Effect probably benign
Transcript: ENSMUST00000044165
AA Change: K175E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: K175E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 105 8.95e-7 SMART
low complexity region 181 191 N/A INTRINSIC
Int_alpha 244 297 2.12e-8 SMART
Int_alpha 301 356 1.68e-11 SMART
Int_alpha 361 416 2.9e-15 SMART
Int_alpha 423 476 1.11e-2 SMART
SCOP:d1m1xa2 626 766 3e-32 SMART
SCOP:d1m1xa3 769 970 1e-39 SMART
transmembrane domain 981 1003 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Bcam T C 7: 19,769,307 probably null Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fam184a T C 10: 53,634,393 probably benign Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Fcgr3 A G 1: 171,059,301 L18P probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Grin2d G T 7: 45,866,176 S131* probably null Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hdac9 T C 12: 34,374,140 probably null Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Ppp2r5d T C 17: 46,686,280 S329G possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnxb C A 17: 34,682,196 L995I possibly damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Vps11 A T 9: 44,354,506 V492D probably damaging Het
Wdr62 A C 7: 30,270,444 probably null Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Itga9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Itga9 APN 9 118769159 start codon destroyed probably null 0.02
IGL01396:Itga9 APN 9 118607123 splice site probably benign
IGL01476:Itga9 APN 9 118607111 missense probably damaging 1.00
IGL01573:Itga9 APN 9 118877230 splice site probably benign
IGL01958:Itga9 APN 9 118636494 splice site probably benign
IGL02060:Itga9 APN 9 118661432 missense probably damaging 1.00
IGL02146:Itga9 APN 9 118834332 missense possibly damaging 0.50
IGL02391:Itga9 APN 9 118850805 missense probably benign 0.19
IGL02947:Itga9 APN 9 118658533 missense probably damaging 1.00
IGL03014:Itga9 UTSW 9 118628144 missense probably benign
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0052:Itga9 UTSW 9 118636549 missense probably damaging 1.00
R0142:Itga9 UTSW 9 118636586 missense probably damaging 0.96
R0179:Itga9 UTSW 9 118661386 missense probably benign 0.11
R0207:Itga9 UTSW 9 118769253 splice site probably benign
R0364:Itga9 UTSW 9 118841142 missense probably benign
R0458:Itga9 UTSW 9 118681028 critical splice donor site probably null
R1486:Itga9 UTSW 9 118626450 missense probably damaging 0.98
R1589:Itga9 UTSW 9 118607117 critical splice donor site probably null
R1620:Itga9 UTSW 9 118843502 missense probably benign 0.00
R1711:Itga9 UTSW 9 118698461 missense probably benign 0.00
R1721:Itga9 UTSW 9 118698306 splice site probably benign
R2064:Itga9 UTSW 9 118807293 missense probably damaging 0.99
R2201:Itga9 UTSW 9 118877115 splice site probably benign
R2851:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R2853:Itga9 UTSW 9 118636536 missense probably damaging 0.98
R3962:Itga9 UTSW 9 118628186 missense possibly damaging 0.57
R4180:Itga9 UTSW 9 118607078 missense probably damaging 1.00
R4597:Itga9 UTSW 9 118843514 missense probably damaging 1.00
R4716:Itga9 UTSW 9 118681758 missense probably damaging 0.98
R4929:Itga9 UTSW 9 118807249 missense probably damaging 1.00
R5002:Itga9 UTSW 9 118663898 nonsense probably null
R5279:Itga9 UTSW 9 118628205 missense probably damaging 1.00
R5542:Itga9 UTSW 9 118843661 missense possibly damaging 0.86
R5869:Itga9 UTSW 9 118663889 missense probably damaging 1.00
R6372:Itga9 UTSW 9 118897321 missense probably damaging 1.00
R6470:Itga9 UTSW 9 118897267 missense probably damaging 0.99
R6581:Itga9 UTSW 9 118658564 missense probably benign 0.00
R6919:Itga9 UTSW 9 118887815 missense probably damaging 1.00
R7034:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7036:Itga9 UTSW 9 118698365 missense probably benign 0.00
R7043:Itga9 UTSW 9 118769116 missense probably damaging 0.96
R7491:Itga9 UTSW 9 118769111 missense probably damaging 0.99
R7629:Itga9 UTSW 9 118698446 missense probably benign 0.00
R7774:Itga9 UTSW 9 118871900 missense probably damaging 1.00
R7782:Itga9 UTSW 9 118843644 missense
R7789:Itga9 UTSW 9 118658496 missense possibly damaging 0.80
R7987:Itga9 UTSW 9 118877226 splice site probably null
Z1176:Itga9 UTSW 9 118843530 missense probably benign 0.00
Z1176:Itga9 UTSW 9 118887839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCTCAGGAGCTGGTTC -3'
(R):5'- GTTGCCTCTTCCATGGACATG -3'

Sequencing Primer
(F):5'- GACTCTCAGGAGCTGGTTCTTCTC -3'
(R):5'- CATGACATTGATGCCAGAGTCGATC -3'
Posted On2019-06-26