Incidental Mutation 'R7237:Hdac9'
ID562919
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7237 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 34374140 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
Predicted Effect probably null
Transcript: ENSMUST00000110819
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209667
Predicted Effect probably null
Transcript: ENSMUST00000209750
Predicted Effect probably null
Transcript: ENSMUST00000209902
Predicted Effect probably null
Transcript: ENSMUST00000209990
Predicted Effect probably benign
Transcript: ENSMUST00000210724
Predicted Effect probably null
Transcript: ENSMUST00000211107
Predicted Effect probably benign
Transcript: ENSMUST00000211752
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Bcam T C 7: 19,769,307 probably null Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fam184a T C 10: 53,634,393 probably benign Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Fcgr3 A G 1: 171,059,301 L18P probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Grin2d G T 7: 45,866,176 S131* probably null Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Itga9 A G 9: 118,636,602 K175E probably benign Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Ppp2r5d T C 17: 46,686,280 S329G possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnxb C A 17: 34,682,196 L995I possibly damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Vps11 A T 9: 44,354,506 V492D probably damaging Het
Wdr62 A C 7: 30,270,444 probably null Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
R7917:Hdac9 UTSW 12 34433210 missense probably benign 0.31
R7974:Hdac9 UTSW 12 34303220 missense possibly damaging 0.87
R7990:Hdac9 UTSW 12 34215453 missense probably benign 0.05
R8489:Hdac9 UTSW 12 34437181 missense probably damaging 1.00
R8683:Hdac9 UTSW 12 34390221 missense probably damaging 1.00
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTTCATCGCTGTCCACGG -3'
(R):5'- ATTAGGAGGACTGTCGTGCAATAC -3'

Sequencing Primer
(F):5'- ATCGCTGTCCACGGGTTCC -3'
(R):5'- GCAATACGTCCTTGTGAGAAAAGTC -3'
Posted On2019-06-26