Mutagenetix > Incidental Mutation

Incidental Mutation 'R7237:Kif13a'

562924

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R7237 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 46809156 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000055304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000056978

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000225591

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

98% (83/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap21	A	T	2: 20,849,972	C1536*	probably null	Het
Armc9	C	A	1: 86,164,849	Q169K	possibly damaging	Het
Aspm	T	A	1: 139,477,929	M1518K	possibly damaging	Het
AU018091	A	G	7: 3,159,166	I360T	probably benign	Het
BB014433	C	A	8: 15,041,765	V363L	probably benign	Het
Bcam	T	C	7: 19,769,307		probably null	Het
Cacna1g	T	C	11: 94,437,879	S1071G	probably benign	Het
Card9	A	T	2: 26,356,775	S354T	probably benign	Het
Ccdc87	A	G	19: 4,839,762	N94S	probably benign	Het
Cdc27	A	G	11: 104,517,419	V555A	probably benign	Het
Coro1a	T	A	7: 126,700,306	D411V	probably benign	Het
Cybrd1	GGTCCTGCAC	G	2: 71,118,209		probably benign	Het
Cyth1	A	T	11: 118,185,495	I95N	probably damaging	Het
Ddx58	T	A	4: 40,205,938	I885F	probably benign	Het
Dnah7b	A	T	1: 46,139,966	E933V	probably damaging	Het
Dync2h1	A	T	9: 6,993,966	I3968N	probably benign	Het
Fam126b	G	A	1: 58,529,948	Q491*	probably null	Het
Fam184a	T	C	10: 53,634,393		probably benign	Het
Fat3	G	A	9: 16,377,214	L338F	probably damaging	Het
Fcgr3	A	G	1: 171,059,301	L18P	probably damaging	Het
Gbp5	T	C	3: 142,507,700	V459A	probably benign	Het
Gja4	A	T	4: 127,312,163	M269K	probably benign	Het
Gm4787	A	G	12: 81,377,668	V572A	probably damaging	Het
Grin2d	G	T	7: 45,866,176	S131*	probably null	Het
Gys1	A	G	7: 45,455,162	D671G	probably benign	Het
Haspin	T	C	11: 73,136,886	N459S	probably benign	Het
Hdac10	G	T	15: 89,125,377	Q451K	probably benign	Het
Hdac9	T	C	12: 34,374,140		probably null	Het
Hmcn1	A	G	1: 150,722,643	V1636A	probably damaging	Het
Hpca	A	G	4: 129,118,614	L43P	probably damaging	Het
Insm1	C	A	2: 146,222,528	A88E	possibly damaging	Het
Itga9	A	G	9: 118,636,602	K175E	probably benign	Het
Kif20b	T	A	19: 34,950,605	L1089H	probably damaging	Het
Lamp5	A	T	2: 136,059,835	H152L	probably benign	Het
Lrp4	T	C	2: 91,473,183	F76L	probably benign	Het
Magi3	T	C	3: 104,027,911	D902G	probably damaging	Het
Map10	C	T	8: 125,671,224	P452L	probably benign	Het
Mapk6	A	G	9: 75,397,613	L174P	probably damaging	Het
Ndufa4	C	T	6: 11,906,019		probably null	Het
Nedd4	A	T	9: 72,725,064	E393D	probably benign	Het
Nlrp4b	G	A	7: 10,715,216	V449I	probably benign	Het
Nufip2	T	A	11: 77,692,770	N503K	probably benign	Het
Olfr220	C	T	1: 174,449,339	R239C	probably benign	Het
Olfr455	T	C	6: 42,538,647	D125G	probably damaging	Het
P4ha1	A	G	10: 59,348,243	T176A	probably benign	Het
Palm3	A	G	8: 84,029,488	K543R	probably benign	Het
Parvg	G	A	15: 84,341,356	A302T	probably benign	Het
Pcdh15	A	G	10: 74,584,191	D1227G	possibly damaging	Het
Pdzd8	C	T	19: 59,345,139	G150D	probably damaging	Het
Pitpnm2	A	G	5: 124,125,297		probably null	Het
Pld5	T	C	1: 176,274,735	Q47R	possibly damaging	Het
Ppp2r5d	T	C	17: 46,686,280	S329G	possibly damaging	Het
Prss56	T	C	1: 87,184,915	V144A	probably damaging	Het
Psg28	A	T	7: 18,427,844	Y245N	possibly damaging	Het
Ptpn3	C	T	4: 57,239,625	V302I	probably damaging	Het
Ptprn2	A	G	12: 117,161,727	H627R	probably benign	Het
Rasgrp2	A	T	19: 6,404,808	H226L	possibly damaging	Het
Rbm20	C	T	19: 53,851,499	T973M	probably benign	Het
Riok2	T	A	17: 17,377,783	L44Q	probably damaging	Het
Rusc1	G	T	3: 89,091,498	Q326K	possibly damaging	Het
Sart3	A	T	5: 113,754,246	H397Q	possibly damaging	Het
Sec31b	T	A	19: 44,517,708	T920S	probably damaging	Het
Serpinb13	A	G	1: 106,998,949	E225G	probably damaging	Het
Slc25a47	T	C	12: 108,855,460	L165P	probably damaging	Het
Slc2a10	G	A	2: 165,515,277	V286I	probably benign	Het
Slc39a13	G	T	2: 91,065,634	T174N	probably benign	Het
Slc7a13	T	A	4: 19,839,364	N322K	probably benign	Het
Stk38	T	C	17: 28,974,646	T326A	possibly damaging	Het
Sult1a1	T	C	7: 126,673,450	M244V	probably benign	Het
Tas2r144	C	T	6: 42,215,866	T180I	probably damaging	Het
Tbc1d12	T	A	19: 38,898,902	M366K	probably benign	Het
Terb1	T	C	8: 104,495,327	I147V	possibly damaging	Het
Tldc1	C	T	8: 119,762,315	G410S	probably damaging	Het
Tmem5	A	T	10: 122,081,618	L330*	probably null	Het
Tnik	T	C	3: 28,638,419	Y820H	probably damaging	Het
Tnxb	C	A	17: 34,682,196	L995I	possibly damaging	Het
Trim34b	A	G	7: 104,329,587	T14A	possibly damaging	Het
Urb1	T	C	16: 90,791,166	E418G	probably damaging	Het
Vmn1r12	T	A	6: 57,159,565	C216S	possibly damaging	Het
Vmn2r90	T	A	17: 17,703,987	V16E	possibly damaging	Het
Vps11	A	T	9: 44,354,506	V492D	probably damaging	Het
Wdr62	A	C	7: 30,270,444		probably null	Het
Zc3h14	T	A	12: 98,780,149	M539K	probably benign	Het
Zfp871	A	T	17: 32,775,315	H295Q	probably damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46791401	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2016:Kif13a	UTSW	13	46810799	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5329:Kif13a	UTSW	13	46775401	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46801313	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
R8806:Kif13a	UTSW	13	46761337	missense	possibly damaging	0.49
R8871:Kif13a	UTSW	13	46830803	missense	probably damaging	1.00
R8877:Kif13a	UTSW	13	46801445	critical splice acceptor site	probably null
R8906:Kif13a	UTSW	13	46773678	missense	probably benign	0.17
R9028:Kif13a	UTSW	13	46798365	missense	probably damaging	1.00
R9058:Kif13a	UTSW	13	46791465	missense	probably damaging	1.00
R9062:Kif13a	UTSW	13	46788060	missense	possibly damaging	0.91
R9070:Kif13a	UTSW	13	46752458	missense	probably benign	0.00
R9083:Kif13a	UTSW	13	46812787	missense	probably damaging	1.00
R9250:Kif13a	UTSW	13	46775433	missense	probably damaging	1.00
R9328:Kif13a	UTSW	13	46798362	missense	probably damaging	1.00
R9360:Kif13a	UTSW	13	46808996	missense	probably benign	0.01
R9369:Kif13a	UTSW	13	46786623	missense	probably damaging	0.99
R9589:Kif13a	UTSW	13	46802544	missense	probably benign	0.01
R9749:Kif13a	UTSW	13	46760751	missense	probably damaging	0.96
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- CTCGTAGTTGTAGTCTGGCTCC -3'
(R):5'- TCCCAGAATGCATCCGTTAGG -3'

Sequencing Primer
(F):5'- TCGCAGCGTCTAGATCGTG -3'
(R):5'- TTAGGAGACCGGTCCCTGTC -3'

Posted On

2019-06-26