Incidental Mutation 'R7237:Ppp2r5d'
List |< first << previous [record 53 of 85] next >> last >|
ID562933
Institutional Source Beutler Lab
Gene Symbol Ppp2r5d
Ensembl Gene ENSMUSG00000059409
Gene Nameprotein phosphatase 2, regulatory subunit B', delta
SynonymsTEG-271, B'delta, Tex271
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7237 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46682991-46705002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46686280 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 329 (S329G)
Ref Sequence ENSEMBL: ENSMUSP00000002839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002839] [ENSMUST00000002845]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002839
AA Change: S329G

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002839
Gene: ENSMUSG00000059409
AA Change: S329G

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
Pfam:B56 95 505 6.2e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002845
SMART Domains Protein: ENSMUSP00000002845
Gene: ENSMUSG00000002768

DomainStartEndE-ValueType
Pfam:MEA1 1 174 1.6e-121 PFAM
Meta Mutation Damage Score 0.2854 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a delta isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trap allele exhibit lethality, while heterozygous mice display decreased prepulse inhibition. Mice homozygous for a targeted knock-out allele exhibit decreased thermal nociception threshold, impaired coordination, and increasedlatency to removing an adhesive sticker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,849,972 C1536* probably null Het
Armc9 C A 1: 86,164,849 Q169K possibly damaging Het
Aspm T A 1: 139,477,929 M1518K possibly damaging Het
AU018091 A G 7: 3,159,166 I360T probably benign Het
BB014433 C A 8: 15,041,765 V363L probably benign Het
Bcam T C 7: 19,769,307 probably null Het
Cacna1g T C 11: 94,437,879 S1071G probably benign Het
Card9 A T 2: 26,356,775 S354T probably benign Het
Ccdc87 A G 19: 4,839,762 N94S probably benign Het
Cdc27 A G 11: 104,517,419 V555A probably benign Het
Coro1a T A 7: 126,700,306 D411V probably benign Het
Cybrd1 GGTCCTGCAC G 2: 71,118,209 probably benign Het
Cyth1 A T 11: 118,185,495 I95N probably damaging Het
Ddx58 T A 4: 40,205,938 I885F probably benign Het
Dnah7b A T 1: 46,139,966 E933V probably damaging Het
Dync2h1 A T 9: 6,993,966 I3968N probably benign Het
Fam126b G A 1: 58,529,948 Q491* probably null Het
Fam184a T C 10: 53,634,393 probably benign Het
Fat3 G A 9: 16,377,214 L338F probably damaging Het
Fcgr3 A G 1: 171,059,301 L18P probably damaging Het
Gbp5 T C 3: 142,507,700 V459A probably benign Het
Gja4 A T 4: 127,312,163 M269K probably benign Het
Gm4787 A G 12: 81,377,668 V572A probably damaging Het
Grin2d G T 7: 45,866,176 S131* probably null Het
Gys1 A G 7: 45,455,162 D671G probably benign Het
Haspin T C 11: 73,136,886 N459S probably benign Het
Hdac10 G T 15: 89,125,377 Q451K probably benign Het
Hdac9 T C 12: 34,374,140 probably null Het
Hmcn1 A G 1: 150,722,643 V1636A probably damaging Het
Hpca A G 4: 129,118,614 L43P probably damaging Het
Insm1 C A 2: 146,222,528 A88E possibly damaging Het
Itga9 A G 9: 118,636,602 K175E probably benign Het
Kif13a A G 13: 46,809,156 probably null Het
Kif20b T A 19: 34,950,605 L1089H probably damaging Het
Lamp5 A T 2: 136,059,835 H152L probably benign Het
Lrp4 T C 2: 91,473,183 F76L probably benign Het
Magi3 T C 3: 104,027,911 D902G probably damaging Het
Map10 C T 8: 125,671,224 P452L probably benign Het
Mapk6 A G 9: 75,397,613 L174P probably damaging Het
Ndufa4 C T 6: 11,906,019 probably null Het
Nedd4 A T 9: 72,725,064 E393D probably benign Het
Nlrp4b G A 7: 10,715,216 V449I probably benign Het
Nufip2 T A 11: 77,692,770 N503K probably benign Het
Olfr220 C T 1: 174,449,339 R239C probably benign Het
Olfr455 T C 6: 42,538,647 D125G probably damaging Het
P4ha1 A G 10: 59,348,243 T176A probably benign Het
Palm3 A G 8: 84,029,488 K543R probably benign Het
Parvg G A 15: 84,341,356 A302T probably benign Het
Pcdh15 A G 10: 74,584,191 D1227G possibly damaging Het
Pdzd8 C T 19: 59,345,139 G150D probably damaging Het
Pitpnm2 A G 5: 124,125,297 probably null Het
Pld5 T C 1: 176,274,735 Q47R possibly damaging Het
Prss56 T C 1: 87,184,915 V144A probably damaging Het
Psg28 A T 7: 18,427,844 Y245N possibly damaging Het
Ptpn3 C T 4: 57,239,625 V302I probably damaging Het
Ptprn2 A G 12: 117,161,727 H627R probably benign Het
Rasgrp2 A T 19: 6,404,808 H226L possibly damaging Het
Rbm20 C T 19: 53,851,499 T973M probably benign Het
Riok2 T A 17: 17,377,783 L44Q probably damaging Het
Rusc1 G T 3: 89,091,498 Q326K possibly damaging Het
Sart3 A T 5: 113,754,246 H397Q possibly damaging Het
Sec31b T A 19: 44,517,708 T920S probably damaging Het
Serpinb13 A G 1: 106,998,949 E225G probably damaging Het
Slc25a47 T C 12: 108,855,460 L165P probably damaging Het
Slc2a10 G A 2: 165,515,277 V286I probably benign Het
Slc39a13 G T 2: 91,065,634 T174N probably benign Het
Slc7a13 T A 4: 19,839,364 N322K probably benign Het
Stk38 T C 17: 28,974,646 T326A possibly damaging Het
Sult1a1 T C 7: 126,673,450 M244V probably benign Het
Tas2r144 C T 6: 42,215,866 T180I probably damaging Het
Tbc1d12 T A 19: 38,898,902 M366K probably benign Het
Terb1 T C 8: 104,495,327 I147V possibly damaging Het
Tldc1 C T 8: 119,762,315 G410S probably damaging Het
Tmem5 A T 10: 122,081,618 L330* probably null Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnxb C A 17: 34,682,196 L995I possibly damaging Het
Trim34b A G 7: 104,329,587 T14A possibly damaging Het
Urb1 T C 16: 90,791,166 E418G probably damaging Het
Vmn1r12 T A 6: 57,159,565 C216S possibly damaging Het
Vmn2r90 T A 17: 17,703,987 V16E possibly damaging Het
Vps11 A T 9: 44,354,506 V492D probably damaging Het
Wdr62 A C 7: 30,270,444 probably null Het
Zc3h14 T A 12: 98,780,149 M539K probably benign Het
Zfp871 A T 17: 32,775,315 H295Q probably damaging Het
Other mutations in Ppp2r5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ppp2r5d APN 17 46685517 critical splice donor site probably null
IGL01570:Ppp2r5d APN 17 46687917 missense possibly damaging 0.64
IGL02504:Ppp2r5d APN 17 46700093 missense probably benign 0.34
R0620:Ppp2r5d UTSW 17 46684018 missense probably benign
R0665:Ppp2r5d UTSW 17 46686404 missense probably damaging 1.00
R1584:Ppp2r5d UTSW 17 46684684 missense probably benign 0.45
R1989:Ppp2r5d UTSW 17 46684099 missense probably benign 0.00
R4261:Ppp2r5d UTSW 17 46687081 nonsense probably null
R5577:Ppp2r5d UTSW 17 46687975 missense probably benign 0.00
R5717:Ppp2r5d UTSW 17 46687894 missense probably damaging 0.99
R6266:Ppp2r5d UTSW 17 46685703 splice site probably null
R6491:Ppp2r5d UTSW 17 46685583 missense probably damaging 1.00
R6792:Ppp2r5d UTSW 17 46704856 missense probably benign
R7060:Ppp2r5d UTSW 17 46687353 missense possibly damaging 0.63
R7100:Ppp2r5d UTSW 17 46685682 missense probably benign 0.03
R7197:Ppp2r5d UTSW 17 46685601 missense probably damaging 0.99
R7231:Ppp2r5d UTSW 17 46684060 missense probably benign 0.00
R7420:Ppp2r5d UTSW 17 46687581 missense probably null 1.00
R7832:Ppp2r5d UTSW 17 46684546 missense probably benign 0.00
R7915:Ppp2r5d UTSW 17 46684546 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTACCGGCTCAGTGAGAC -3'
(R):5'- AGGTGACCGTTTTCCATTAGG -3'

Sequencing Primer
(F):5'- GCTCAGTGAGACTGCTCTC -3'
(R):5'- GGTTTATCTATGAGACTGAGCATCAC -3'
Posted On2019-06-26