Incidental Mutation 'R0578:Srsf11'
ID56295
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Nameserine/arginine-rich splicing factor 11
Synonyms0610009J05Rik, Sfrs11, 2610019N13Rik
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0578 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location158010473-158036639 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 158012067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040787] [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000198705] [ENSMUST00000199727]
Predicted Effect probably benign
Transcript: ENSMUST00000040787
SMART Domains Protein: ENSMUSP00000038662
Gene: ENSMUSG00000039988

DomainStartEndE-ValueType
low complexity region 27 52 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Blast:ANK 108 139 8e-10 BLAST
ANK 143 172 2.66e-5 SMART
ANK 176 205 1.97e1 SMART
Pfam:GPCR_chapero_1 259 533 2.2e-81 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000069025
AA Change: R482Q
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436
AA Change: R482Q

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000072875
AA Change: R458Q
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436
AA Change: R458Q

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121326
AA Change: R493Q
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436
AA Change: R493Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152274
SMART Domains Protein: ENSMUSP00000127239
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 274 356 N/A INTRINSIC
low complexity region 375 382 N/A INTRINSIC
low complexity region 412 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156303
Predicted Effect probably benign
Transcript: ENSMUST00000198705
SMART Domains Protein: ENSMUSP00000142759
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 81 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199520
Predicted Effect probably benign
Transcript: ENSMUST00000199727
SMART Domains Protein: ENSMUSP00000143432
Gene: ENSMUSG00000039988

DomainStartEndE-ValueType
low complexity region 27 52 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Blast:ANK 108 139 2e-9 BLAST
ANK 143 172 1.7e-7 SMART
ANK 176 205 1.3e-1 SMART
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 158012035 unclassified probably benign
IGL01600:Srsf11 APN 3 158019442 splice site probably benign
IGL02724:Srsf11 APN 3 158016431 unclassified probably benign
IGL03147:Srsf11 UTSW 3 158026740 missense probably damaging 1.00
R0195:Srsf11 UTSW 3 158036535 unclassified probably benign
R0580:Srsf11 UTSW 3 158012067 unclassified probably benign
R1075:Srsf11 UTSW 3 158012790 intron probably benign
R1604:Srsf11 UTSW 3 158019311 critical splice donor site probably null
R1797:Srsf11 UTSW 3 158019428 missense possibly damaging 0.92
R1815:Srsf11 UTSW 3 158016427 unclassified probably benign
R1899:Srsf11 UTSW 3 158031580 unclassified probably benign
R2105:Srsf11 UTSW 3 158019345 missense probably damaging 0.99
R4605:Srsf11 UTSW 3 158022923 nonsense probably null
R4655:Srsf11 UTSW 3 158023335 missense probably benign 0.15
R4737:Srsf11 UTSW 3 158026732 nonsense probably null
R5244:Srsf11 UTSW 3 158023344 unclassified probably benign
R5245:Srsf11 UTSW 3 158023344 unclassified probably benign
R5379:Srsf11 UTSW 3 158023344 unclassified probably benign
R5401:Srsf11 UTSW 3 158023344 unclassified probably benign
R5625:Srsf11 UTSW 3 158023344 unclassified probably benign
R5763:Srsf11 UTSW 3 158023344 unclassified probably benign
R5814:Srsf11 UTSW 3 158023344 unclassified probably benign
R5938:Srsf11 UTSW 3 158023344 unclassified probably benign
R5944:Srsf11 UTSW 3 158023344 unclassified probably benign
R5945:Srsf11 UTSW 3 158023344 unclassified probably benign
R6126:Srsf11 UTSW 3 158023344 unclassified probably benign
R6175:Srsf11 UTSW 3 158023344 unclassified probably benign
R6427:Srsf11 UTSW 3 158023344 unclassified probably benign
R6435:Srsf11 UTSW 3 158023344 unclassified probably benign
R6436:Srsf11 UTSW 3 158023344 unclassified probably benign
R6614:Srsf11 UTSW 3 158023344 unclassified probably benign
R6616:Srsf11 UTSW 3 158023344 unclassified probably benign
R7615:Srsf11 UTSW 3 158016425 missense unknown
X0017:Srsf11 UTSW 3 158016349 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATTCCCTACATGGCTCTATCACG -3'
(R):5'- TCCTTGTCAAAGCAGGTGACTCG -3'

Sequencing Primer
(F):5'- GCTGCTTGATCACGCAAATG -3'
(R):5'- AGCAGGTGACTCGGGATTATG -3'
Posted On2013-07-11