Incidental Mutation 'R7238:1110002E22Rik'
List |< first << previous [record 149 of 468117] next >> last >|
ID562958
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R7238 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138069951 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1634 (T1634S)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: T1634S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: T1634S

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 97% (104/107)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
4933402N22Rik T C 5: 11,920,745 I127T Het
5830473C10Rik A T 5: 90,579,660 Y379F probably damaging Het
Adgrl1 T A 8: 83,939,064 M1460K probably damaging Het
Adig T A 2: 158,505,853 L29Q unknown Het
Adnp T G 2: 168,183,967 K469N probably damaging Het
Akap3 A G 6: 126,865,237 D273G probably benign Het
Ankrd34b T C 13: 92,438,631 Y124H possibly damaging Het
Ap2b1 T G 11: 83,333,122 F221C possibly damaging Het
Atp2c2 A G 8: 119,742,421 I358V possibly damaging Het
BC051665 G A 13: 60,782,722 T272I probably benign Het
BC117090 C T 16: 36,321,831 G61D probably benign Het
Cdan1 G T 2: 120,730,302 A262E probably benign Het
Ces1d C T 8: 93,178,135 V326I probably benign Het
Chd3 T C 11: 69,364,047 R156G probably benign Het
Clip1 C T 5: 123,613,265 E818K Het
Col6a4 C T 9: 106,000,320 V2153M probably damaging Het
Crlf3 T C 11: 80,056,525 N296D possibly damaging Het
D130052B06Rik A G 11: 33,623,594 I109V probably benign Het
Dcaf5 G T 12: 80,338,709 T881K probably benign Het
Dennd4a C A 9: 64,861,956 T408K probably damaging Het
Dnah2 A G 11: 69,459,146 probably null Het
Eif2ak2 C T 17: 78,866,331 V273I probably benign Het
Elac1 C T 18: 73,739,288 G212D probably damaging Het
Ercc6l2 A G 13: 63,865,984 D623G probably damaging Het
Exo1 T C 1: 175,888,847 F177L probably damaging Het
Fat4 A G 3: 38,890,413 T1152A probably benign Het
Fbxl12 G T 9: 20,618,413 probably null Het
Fbxo43 T C 15: 36,151,825 Y582C probably damaging Het
Fsip2 T A 2: 82,982,140 N2934K possibly damaging Het
Gm4951 A G 18: 60,246,283 S297G possibly damaging Het
Gm8300 A T 12: 87,517,236 K114* probably null Het
Gna12 A G 5: 140,830,092 S69P probably damaging Het
Gpatch8 C A 11: 102,478,528 G1395C probably damaging Het
Gpr137c A G 14: 45,278,691 Y294C probably damaging Het
Greb1 A G 12: 16,674,672 S1834P probably damaging Het
Grin2b T C 6: 135,780,251 D404G probably damaging Het
Hectd2 A T 19: 36,597,078 N236I probably damaging Het
Hhip C T 8: 79,987,012 V562I probably benign Het
Hipk2 G T 6: 38,716,057 T867N probably benign Het
Hmgcl T C 4: 135,962,113 V294A possibly damaging Het
Hnrnpl T A 7: 28,813,975 F158I Het
Hspa5 T C 2: 34,772,371 V17A unknown Het
Hspg2 T C 4: 137,508,393 V168A probably damaging Het
Idh1 A G 1: 65,166,125 F227S probably damaging Het
Immp2l T C 12: 41,110,916 V71A possibly damaging Het
Iqce G A 5: 140,689,958 R193* probably null Het
Kcnq5 T C 1: 21,402,302 D907G probably benign Het
Krt17 T A 11: 100,257,787 T306S probably benign Het
Lhx3 T C 2: 26,202,997 D149G probably damaging Het
Lrrc73 G A 17: 46,254,562 R73H probably damaging Het
Mgat5b T C 11: 116,984,983 S678P probably benign Het
Mink1 T C 11: 70,611,479 probably null Het
Mroh5 T G 15: 73,791,429 probably null Het
Muc5ac T A 7: 141,809,517 H2188Q unknown Het
Muc5ac G C 7: 141,809,687 probably benign Het
Musk G A 4: 58,344,312 G305D probably benign Het
Mx1 A G 16: 97,448,296 I347T unknown Het
Mybbp1a G T 11: 72,443,512 V198F probably damaging Het
Mycbp2 A G 14: 103,156,297 S2943P probably damaging Het
Myo18a G A 11: 77,842,233 R1363K probably damaging Het
Nav3 T A 10: 109,853,324 D364V possibly damaging Het
Olfr127 T C 17: 37,904,437 L297S probably benign Het
Olfr178 T A 16: 58,889,889 E110D probably damaging Het
Olfr309 T C 7: 86,306,591 H174R probably damaging Het
Olfr341 T A 2: 36,479,714 N139Y possibly damaging Het
Olfr385 A T 11: 73,589,735 M1K probably null Het
Pecr T C 1: 72,259,433 D276G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1cb A T 5: 32,491,032 T320S probably benign Het
Ppp1r9a G T 6: 5,159,716 K1084N probably damaging Het
Prdm2 A G 4: 143,135,821 S300P probably benign Het
Prkg1 C T 19: 30,624,690 V389I probably damaging Het
Psg25 C T 7: 18,532,202 probably benign Het
Ptpn6 A G 6: 124,721,858 S498P possibly damaging Het
Pus3 A G 9: 35,566,669 H399R probably benign Het
Pus7 T C 5: 23,778,452 T6A probably benign Het
Rnf169 A G 7: 99,925,747 V547A probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,921 probably benign Het
Ryr1 C T 7: 29,095,382 D1194N probably benign Het
Scn5a T C 9: 119,491,544 M1490V possibly damaging Het
Sec23b A G 2: 144,590,338 D756G possibly damaging Het
Selenoo T A 15: 89,089,224 M39K probably benign Het
Sept8 T G 11: 53,536,692 V246G possibly damaging Het
Serpina3k T A 12: 104,343,108 N270K probably damaging Het
Setd5 G A 6: 113,121,130 R710H probably damaging Het
Sirt4 A T 5: 115,482,990 I41N possibly damaging Het
Slc26a9 T A 1: 131,758,818 Y425* probably null Het
Slc4a9 A G 18: 36,529,720 E176G probably benign Het
Spidr A T 16: 15,966,816 W463R probably benign Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmcc1 G A 6: 116,134,237 Q28* probably null Het
Tmem52b A G 6: 129,516,688 E88G probably damaging Het
Trpc7 A T 13: 56,826,897 I402K probably benign Het
Tshz3 T C 7: 36,770,097 Y504H probably damaging Het
Ttn T C 2: 76,712,205 E33479G possibly damaging Het
Ttn G A 2: 76,881,328 R8290C unknown Het
Urb1 T C 16: 90,752,115 D2235G possibly damaging Het
Usp10 T C 8: 119,941,544 F195L probably benign Het
Vmn1r31 A T 6: 58,472,873 F2L Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r12 G A 5: 109,097,789 P26S possibly damaging Het
Vmn2r61 T A 7: 42,267,205 M414K possibly damaging Het
Yipf3 T C 17: 46,251,659 V330A probably benign Het
Zic4 A T 9: 91,379,397 H235L probably benign Het
Zxdc T A 6: 90,369,660 W16R unknown Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACCACCAGCAGGCATTG -3'
(R):5'- AGTACGGGGCTTCAGTGAAC -3'

Sequencing Primer
(F):5'- AGCCTCAGGTCCTCTGC -3'
(R):5'- TGTAGCCACAGAGAGCTCACTG -3'
Posted On2019-06-26